Introduction
Spinal cord injury (SCI), as the name suggests, refers to damage to the spinal cord, which is a crucial part of the central nervous system responsible for controlling movement and sensation in the body. It can lead to impairment in function and sensation in the affected area, as well as in parts of the body below the injury site. This injury can have a significant impact on an individual’s life, resulting in loss of mobility, difficulties with bowel and bladder control, and persistent pain [
1]. Macrophages are specialized immune cells that play a critical role in the immune response in various diseases such as musculoskeletal ailments, renal diseases and SCI [
2‐
5]. They are divided into two major types: M1 and M2 macrophages, and the balance between M1 and M2 macrophages is crucial for optimal healing and functional recovery after SCI [
6]. Research has shown that an imbalance in macrophage polarization can contribute to the persistence of inflammation, neuropathic pain, and poor functional outcomes [
7,
8]. Therefore, modulating macrophage polarization becomes an important strategy in the treatment and management of SCI. However, the mechanism of macrophage polarization after SCI remains unclear.
Trans-acting transcription factor 1, also known as SP1, is a key protein involved in regulating gene expression. SP1 binds to specific DNA sequences and controls the transcription of various target genes [
9]. In humans, SP1 plays a critical role in various biological processes, including cell growth, development, and differentiation [
10]. Specifically, SP1 has been shown to regulate the expression of neurotrophic factors, such as brain-derived neurotrophic factor (BDNF), which are crucial for neuronal survival and regeneration [
11]. SP1 has been extensively studied and found to have diverse roles in human diseases, particularly in spinal cord injury [
12,
13]. Studies have shown that SP1 can modulate neuroinflammation and cellular apoptosis following SCI [
14]. Understanding the precise role and mechanism of SP1 in SCI are crucial for developing targeted therapeutic strategies.
5-Hydroxytryptamine (serotonin) receptor 2B, also known as HTR2B, is a type of receptor for the neurotransmitter serotonin (5-HT) [
15]. Serotonin is a key signaling molecule in the brain and plays a crucial role in regulating various physiological and behavioral processes, including mood, sleep, and appetite. In addition to its role in normal physiological functions, HTR2B has been associated with various human diseases. It has been extensively studied to understand its involvement in conditions such as cardiovascular diseases, psychiatric disorders, and cancer [
15‐
17]. In particular, HTR2B has been found to promote M1 microglia polarization as well as inflammation following SCI through regulation of neuregulin-1/ErbB pathway [
18].
We found that SP1 potentially bound to the promoter region of the HTR2B gene through the JASPAR online database, indicating that SP1 might transcriptionally activate HTR2B to modulate SCI. However, whether HTR2B is involved in the regulation of SP1 in spinal cord injury has not been reported. Further research is needed to reveal the interactions between these molecules in spinal cord injury. Understanding these mechanisms can provide new targets for the treatment of spinal cord injury, thereby improving patient outcomes.
Materials and methods
Microglia culture and treatment
Mouse microglia (BV2) was purchased from EK-Bioscience (Shanghai, China) and cultured in DMEM (Oumarsi Biotech, Shanghai, China) supplemented with 10% FBS and 1% penicillin/streptomycin (Cytiva, Shanghai, China) at 37℃ with 5% CO
2. BV2 cells were exposed to lipopolysaccharide (1 µg/mL, Abmole Bioscience, Shanghai, China) for 24 h to investigate macrophage polarization, as instructed [
19].
Cell transfection
Ribobio Co., Ltd. (Guangzhou, China) synthesized small hairpin RNAs of SP1 (sh-SP1, Accession, NM_013672.2, 5’-CCAACTTACAGAACCAGCAAGTTCT-3’) and HTR2B (sh-THR2B, Accession: NM_008311.3, 5’-GATCCTGACTAACCGTTCTGGATTA-3’). Coding sequence of SP1 (101 to 2446 bp of the SP1 gene) was amplified by polymerase chain reaction (PCR) using specific primers with restriction sites and then inserted into the pcDNA 3.1 vector (Genomeditech, Shanghai, China) to establish SP1 overexpression plasmid (oe-SP1). Similarly, the HTR2B gene was amplified by PCR from 337 to 1776 bp, and the resulting fragment was used to construct an overexpression plasmid for HTR2B (oe-HTR2B) using pcDNA 3.1 vector. The day before transfection, the BV2 cells were passaged at a suitable density and allowed to reach a density between 50 and 70%. This ensures that the cells are in the logarithmic growth phase when they are transfected. Cells were transferred into 6-well plates with 1600 µL of DMEM without serum. The oligonucleotides, vectors, and transfection reagent LipoFiter (Hanbio, Shanghai, China) were mixed with the culture medium separately and allowed to incubate at room temperature for 5 min. The plasmid and liposomes were gently mixed together and then directly added to the cells in 6-well plates. The plates were then transferred to the incubator for culturing for 48 h.
Western blotting assay
The processed cells were gently scraped and collected in centrifuge tubes. The spinal cord tissues of each mouse were cut with scissors and placed in centrifuge tubes. Each tube was then added with 300 µL of cell lysis buffer RIPA (Beyotime, Shanghai, China) and thoroughly lysed on ice. After lysis, the protein concentration of each sample was adjusted to the same level using sterile ddH2O based on the measured protein concentration. An equivalent volume of 5× SDS-PAGE protein loading buffer (Thermo Fisher, Waltham, MA, USA) was added to each sample and incubated in a boiling water bath for 10 min. The electrophoresis tank was filled with electrophoresis buffer, and the samples were quantitated and loaded onto the gel. After bromophenol blue reached the gel bottom, electroblotting was performed. The PVDF membrane obtained after transfer was immersed in skim milk solution prepared in TBST. Subsequently, the membrane was incubated with the primary antibodies against SP1 (#AF6121, 1:1000, Affinity, Nanjing, China), HTR2B (#DF3500, 1:1000, Affinity), BCL2-associated x protein (Bax, #AF0120, 1:1000, Affinity), B-cell lymphoma-2 (Bcl-2, #AF6139, 1:1000, Affinity), inducible nitric oxide synthase (iNOS, #AF0199, 1:1000, Affinity), clusters of differentiation 86 (CD86, #DF6332), Arginase 1 (Arg-1, #DF6657, 1:1000, Affinity) and clusters of differentiation 206 (CD206, #DF4149, 1:1000, Affinity) overnight on a rocking shaker at 4 °C, followed by incubation with a secondary antibody (#S0001, 1:5000, Affinity) on the second day. The chemiluminescent substrate was evenly applied to the protein side of the membrane and visualized using a gel imaging system before capturing the image.
3-(4,5-dimethylthazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
25 mg MTT (Beyotime) was dissolved in 5 mL of dissolving solution, and cell culture was performed in 96-well plates. When the cell confluence reached 70–80%, cell transfection and LPS stimulation were conducted. After 48 h of culture, MTT with a final concentration of 2 µg/mL was added into each well. After 4 h of culture, the cells in each well were analyzed using an enzyme-linked immune detector.
TUNEL cell apoptosis assay
Cell suspensions were prepared at a concentration of approximately 2 × 107 cells/mL in PBS and pipetted onto glass slides coated with poly-L-lysine. The slides were immersed in a staining jar containing 4% fresh polyformaldehyde (Solarbio, Beijing, China) dissolved in PBS, and 100 µL of Proteinase K (Solarbio) was applied to each sample. To analyze cell apoptosis of spinal cord tissues, the tissues were embedded into paraffin and incubated with xylene, ethanol and Proteinase K. Subsequently, 100 µL of 1×Equilibration Buffer was added to cover the entire area of the samples, and TdT incubation buffer was added to the cells. The slides were then placed in a dark staining jar containing a solution of propidium iodide (PI, Solarbio). Excess water was removed from the slides by tapping, and 100 µL of PBS was added to maintain sample moisture. Finally, the samples were analyzed immediately under a fluorescence microscope.
Quantitative real-time PCR (qRT-PCR)
Frozen cells and tissues were allowed to fully dissolve at room temperature for 5 min. 1/5 volume of chloroform to TRIZOL reagent was added, and the aqueous phase was transferred to clean centrifuge tubes free of RNase and mixed with an equal volume of isopropanol to precipitate the RNA. The samples were incubated with 75% ethanol, and the RNA was allowed to dry at room temperature. Subsequently, the obtained RNA was mixed with the primers from the cDNA synthesis kit (Wanleibio, Shenyang, China) and incubated at 70 °C for 5 min, followed by incubation for 5 min on ice. Then, the mixtures were incubated with the M-MLV reverse transcriptase and dNTPs from the cDNA synthesis kit (Wanleibio) at 42 °C for 50 min, and incubated at 80 °C for 10 min to synthesize cDNA. Finally, gene expression was quantified using SYBR Green reagent (TaKaRa, Dalian, China) according to the guidebook and analyzed through the 2
−∆∆Ct method. Primer sequences are shown in Table
1.
Table 1
Primers sequences used for PCR
SP1 | Forward | GTCAGCGTCCGCGTTTTTC |
Reverse | CGCTACCCCCATTATTGCCA |
HTR2B | Forward | CTCAGAGCAAGTCAGTGGGG |
| Reverse | TGTGTACACGTCTGTCCGTG |
β-actin | Forward | GAGCGCAAGTACTCTGTGTG |
Reverse | AACGCAGCTCAGTAACAGTCC |
Chromatin immunoprecipitation (ChIP) assay
According to the instruction manual of the assay kit (#WLA106a; Wanleibio), formaldehyde (Solarbio) was added to each sample and incubated at room temperature for 10 min. Glycine was incubated with the sample, and the medium was removed and washed twice with pre-chilled PBS. The cells were scraped into a 1.5 mL centrifuge tube using a cell scraper, centrifuged to collect the precipitate, and then incubated with Buffer A and Buffer B, as well as EDTA. After terminating the digestion for two min on ice, the precipitate was collected by centrifugation. The nuclear membrane was disrupted using an ultrasound bath, and anti-SP1 antibody (#MA5-35331, 1:100, Thermo Fisher) was added to the samples, which were then incubated overnight at 4 °C on a rocking mixer. The sample was then mixed with magnetic beads, allowing the supernatant to be removed by a magnetic separator. ChIP Elution Buffer was added to the magnetic beads, which were placed at 4 °C for half an hour. After DNA purification, HTR2B expression was analyzed using qRT-PCR.
Dual-luciferase reporter assay
Upon accessing the “JASPAR” website (
http://jaspar.genereg.net/), users entered “SP1” into the search bar and chose the SP1 ID number (MA0079.2) specific to the mouse species when it appeared in the search results. Subsequently, the promoter sequence of HTR2B was inputted into the scanning field, and upon clicking the “Scan” button, the binding sites would be displayed. To view the SP1 sequence logo, users could simply click on the SP1 ID number. The luciferase plasmids of HTR2B were prepared using pGL3-Basic vector and named as site-wt and site-mut. The reporter plasmid containing both the firefly luciferase and Renilla luciferase genes was transfected into each well (24-well plate) at a ratio of 50:1. A Dual-Luciferase Assay kit (Solarbio) was used to analyze luciferase activity according to the instructions. Each well was added with 1x PLB lysis buffer and agitated at room temperature for 15 min. Finally, the samples were detected using an automated luminescence detection instrument.
SCI mouse model
Male adult mice, weighting 20–25 g, were purchased from Hunan Slyke Jingda Experimental Animal Co., LTD (Changsha, China) and housed in experimental animal center. The mice were anesthetized by intraperitoneal injection of chloral hydrate to ensure they were unable to feel pain during the injury procedure. Skin disinfection was conducted and T9-T11 spinous processes were exposed by making a longitudinal incision on the back. Then, T9-T10 laminas were removed and SCI was established by hitting. The retraction of the hind legs and the wagging of the tail in mice indicated that the SCI mouse model has established successfully. The above incisions were sutured layer by layer. Mice in the sham group, only the laminae and spinous processes were removed. Subdural injection of corresponding lentivirus expressing sh-SP1 (FulenGen, Guangzhou, China) or sh-NC (FulenGen) was performed at 5 min after SCI. According to the above methods, the mice were divided into the sham group, the SCI + sh-NC group (referred to as the SCI group in the study), and the SCI + sh-SP1 group. The study was approved by the Animal Care and Use Committee of the First People’s Hospital of Pingdingshan. Animal studies were performed in compliance with the ARRIVE guidelines and the Basel Declaration.
Locomotor function recovery assessment
The Basso Mouse Scale (BMS) was used to analyze neurological function at the defined time points (1, 3, 7, 14, 21 and 28 day following SCI) according to the published method [
20]. In addition, all mice were evaluated with an accelerated rotating rod (0–40 rpm) twice, 20 min apart, to assess capability and coordination of mice by evaluating the speed and duration of each mouse after spinal cord injury.
Haematoxylin and eosin (HE) staining
The spinal cord was removed from all mice, and the excess tissues around the spinal cord were trimmed and rinsed using PBS to remove any debris or blood. The spinal cord was fixed in 10% neutral buffered formalin (Solarbio) and dehydrated using alcohol (Solarbio). The dehydrated tissues were transferred to xylene for complete clearance and embedded in liquid paraffin. The paraffin-embedded blocks were cut using a microtome and transferred to glass slides carefully. Deparaffinization and rehydration were then performed, and the rehydrated sections were immersed in hematoxylin solution (Solarbio) and counterstained using eosin solution (Solarbio). The sections were gradually dehydrated by passing them through increasing alcohol concentrations and observed under a light microscope.
Statistical analysis
GraphPad Prism was used to analyze all data from three independent biological replicates, and results were shown as means ± standard deviations (SD). Significant differences were compared using Student’s t-tests, one-way analysis of variance or two-way analysis of variance. P < 0.05 indicated statistical significance.
Discussion
Spinal cord injury can occur due to various causes such as trauma, infection, or degenerative diseases. Following the injury, there is an immediate immune response characterized by activation of immune cells, release of inflammatory mediators, and recruitment of immune cells to the site of damage [
21]. Macrophages are specialized immune cells and can be M1 (classically activated) or M2 (alternatively activated) phenotype, depending on the signals they receive. M1 macrophages are involved in pro-inflammatory responses and pathogen elimination, while M2 macrophages play a role in tissue repair, wound healing, and anti-inflammatory processes [
22]. The polarization of macrophages in spinal cord injury is a dynamic process that influences the pathogenesis and outcome of the injury. However, the specific mechanism remains unclear. The present work revealed that SP1 transcriptionally activated HTR2B to aggravate traumatic SCI by shifting microglial M1/M2 polarization.
Previous work has revealed that SP1 knockdown inhibited astrocyte proliferation and migration in a SCI cell model [
23]. Additionally, SP1 could promote apoptosis of H
2O
2-induced PC12 cells, a SCI cell model [
24]. SP1 was highly expressed in spinal cord tissues of SCI rat and its downregulation ameliorated cell apoptosis of ischemia/reperfusion-induced spinal cord tissues [
14].We analyzed the role of SP1 in SCI using both LPS-induced BV2 cells and mice with SCI. The results showed that SP1 protein expression was upregulated in both LPS-induced BV2 cells and SCI mouse model. SP1 silencing reversed cell apoptosis induced by LPS and spinal hitting. M1 macrophages typically express high levels of pro-inflammatory cytokines such as TNF-α and IL-1β, while M2 macrophages typically express high levels of anti-inflammatory cytokines such as IL-4 and TGF-β [
25]. iNOS is an enzyme that catalyzes the production of nitric oxide, which plays a crucial role in immune response and is expressed on M1 macrophages [
26]. CD86 is a surface receptor that promotes immune cell activation and is expressed on M1 macrophages [
26]. Arg-1 is an enzyme that catalyzes the conversion of arginine to polyamines, which are essential for cell growth and proliferation and is expressed on M2 macrophages [
27]. CD206 is a surface receptor that promotes immune cell activation and is expressed on M2 macrophages [
27]. Our evaluated the effects of SP1 on macrophage polarization after SCI by analyzing these cytokines and proteins. The results showed that SP1 silencing inhibited TNF-α, IL-1β, iNOS and CD88 expression and promoted IL-4, TGF-β, Arg-1 and CD206 in both LPS-induced BV2 cells and mice with SCI, indicating that SP1 promoted microglia M1 polarization.
As a transcription factor, SP1 binds to specific DNA sequences and promotes the transcription of target genes in human diseases. For example, SP1 transcriptionally activated long non-coding RNA THAP7-AS1 to mediate gastric cancer progression [
28]. SP1 transcriptionally activated NLRP6 to induce radioresistance in glioma cells [
29]. Our results revealed that HTR2B was transcriptionally activated by SP1 in BV2 cells and HTR2B silencing attenuated LPS-induced BV2 cell apoptosis and microglia M1 polarization. Moreover, HTR2B overexpression relieved SP1 silencing-induced effects in LPS-stimulated BV2 cells. A previous study has revealed that HTR2B expression was upregulated in lipopolysaccharide-stimulated microglia and SCI rats [
18]. Similarly, our data showed that LPS-induced BV2 cells and SCI mice showed a high HTR2B expression. It has been reported that HTR2B inhibits the inactivation of Nrg-1/ErbB signaling to promote M1 microglia polarization and neuroinflammation following spinal cord injury [
18]. HTR2B can activate specific signaling pathways such as the PI3K/Akt pathway, which has been shown to enhance cell survival and inhibit apoptosis [
15]. Additionally, hydrogen peroxide exposure can induce oxidative damage, accompanied by a decrease in HTR2B expression [
30], which suggests that HTR2B may inhibit oxidative stress, a trigger for apoptosis. Thus, HTR2B may activate PI3K/Akt pathway and reduce oxidative stress to protect microglia from apoptosis. These results demonstrated that HTR2B was involved in the regulation of SP1 in M1 microglia polarization and microglia apoptosis after SCI.
Thus, SP1 transcriptionally activated HTR2B to promote microglia M1 polarization and microglia apoptosis after SCI. Modulating the macrophage phenotype towards an anti-inflammatory and tissue repair-promoting state may hold promise for developing therapeutic strategies to enhance recovery and functional outcomes in spinal cord injury. However, there are several limitations in using mouse-derived cells and mouse models to study the role and mechanism of SP1 in SCI. Mouse-derived cells and human cells have differences in genomics, proteins, and phenotypes, which may lead to the irreproducibility of research results. In addition, the mouse model may not fully simulate the pathophysiological process of human SCI due to significant differences in the nervous systems between mice and humans. Thus, more accurate and human-relevant methods may help to better understand the microglia polarization and cell apoptosis processes after SCI.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.