Introduction
The t(8;21)(q22;q22) translocation resulting in the RUNX1-ETO (also called AML1-ETO or RUNX1-RUNX1T1) rearrangement is one of the most common genetic alterations in acute myeloid leukemia (AML), accounting for 5–10% of AML cases [
1‐
3]. Patients diagnosed with t(8;21) AML typically experience a favorable prognosis when treated with intensive cytarabine-based chemotherapy. However, a significant number of patients still relapse, highlighting the clinical heterogeneity within t(8;21) AML [
4,
5]. Relapse rates are particularly high in elderly patients who are unable to tolerate high-dose cytotoxic chemotherapy.
RUNX1-ETO alone is not sufficient for leukemogenic transformation and requires additional genetic alterations for progression to full blown AML [
1,
3]. Studies have identified the collaborative genetic alterations, including mutations in
KIT,
ASXL1,
ZBTB7A,
NRAS,
CBL, and
TP53 genes in t(8;21) AML [
5,
6]. Some of these mutations, such as those in
KIT,
ASXL1, and
TP53, negatively affect survival. In particular, loss of the TP53 response pathway has been shown to be associated with drug resistance and disease progression in RUNX1-ETO leukemia [
7], while RUNX1-ETO itself was shown to activate the p53 pathway that sensitizes leukemia cells to DNA damage [
8]. Therefore, new approaches for the treatment of t(8;21) AML patients with
TP53 mutations or deletions need to be developed.
In addition to the full-length RUNX1-ETO, alternatively spliced isoforms of the RUNX1-ETO transcript have been identified in t(8;21) patients. RUNX1-ETO9a [
9], a short isoform of RUNX1-ETO, encodes a C-terminally truncated RUNX1-ETO protein with a stronger leukemogenic potential than full-length RUNX1-ETO. Because RUNX1-ETO9a can induce AML without cooperating mutations in a mouse retroviral transduction-transplantation model, it has been widely used experimentally as mouse models of t(8;21) AML.
In this study, we developed novel mouse models for t(8;21) AML using RUNX1-ETO9a, Trp53 (the mouse homolog of TP53)-deficient mice and Cas9 knockin mice. The established Cas9+, RUNX1-ETO9a-expressing AML cells with/without Trp53 deficiency will be useful tools for the development of effective therapeutic strategies for t(8;21) AML.
Methods
Mice
C57BL/6 mice (Ly5.1) obtained from Sankyo Labo Service Corporation, Tokyo, Japan, were employed in bone marrow transplantation assays.
Trp53−/− mice were sourced from the RIKEN BioResource Center in Ibaragi, Japan [
10]. Rosa26-LSL-Cas9 knockin mice were procured from The Jackson Laboratory (#024857) [
11]. To generate
Trp53−/−-Cas9 mice,
Trp53−/− mice were bred with Cas9 knockin mice. All animal experiments were granted approval by the Animal Care Committee of the Institute of Medical Science at the University of Tokyo (PA21-67) and were carried out in accordance with the Regulation on Animal Experimentation at the University of Tokyo, following the International Guiding Principles for Biomedical Research Involving Animals.
Cell culture
RUNX1-ETO9a-Cas9+ and RUNX1-ETO9a-Trp53−/−-Cas9+ cells were isolated from spleens of leukemic mice. Initially, these cells were cultured in Roswell Park Memorial Institute (RMPI)-1640 medium (#189–02025, FUJIFILM Wako) supplemented with 10% fetal bovine serum (FBS; #FB-1365/500, Biosera), and 1% penicillin–streptomycin (PS, #09367–34, Nacalai), along with the following cytokines: 100 ng/ml SCF (#455-MC, R&D Systems), 10 ng/ml IL-6 (#216–16, PEPROTECH), and 1 ng/ml IL-3 (#213–13, PEPROTECH). The amount of cytokines was gradually reduced, and eventually the cells were maintained in the same medium supplemented only with 1 ng/ml IL-3. When the cryopreserved cells were used, the cells were initially cultured with 100 ng/ml SCF, 10 ng/ml IL-6 and 1 ng/ml IL-3 for one week and then cultured with 1 ng/ml IL-3 only.
cSAM cells were previously generated using a murine transplantation model. Briefly, a C-terminally truncated form of ASXL1 and SETBP-D868N were transduced into mouse bone marrow progenitor cells, and transplanted into sublethally irradiated recipient mice. Leukemic cells were isolated from the bone marrow of the moribund mice and their leukemogenic activity was confirmed by serial transplantation [
12,
13]. The cSAM cells were cultured in RPMI-1640 medium supplemented with 10% FBS and 1 ng/ml IL-3.
Plat-E [
14] and 293 T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) medium (#044–29765, Wako) with 10% FBS and 1% PS.
Plasmids and Viral transduction
HA-tagged RUNX1-ETO9a was employed for RUNX1-ETO9a expression, and it was incorporated into a pMSCV-IRES-Thy1.1 retroviral vector [
15]. Retroviruses were produced by transiently transfecting Plat-E packaging cells using the calcium-phosphate coprecipitation method. The cells were transduced with retroviruses using Retronectin (Takara Bio Inc., Otsu, Shiga, Japan). Lentiviruses were produced by transiently transfecting lentiviral plasmids, along with PCMV-VSV-G (Addgene, #8454) [
16] and psPAX2 (Addgene, #12,260), into 293 T cells with the calcium-phosphate method [
15].
Runx1 depletion using the CRISPR/Cas9
To generate single guide RNA (sgRNA), annealed oligos were incorporated into either the pLentiguide-puro vector (#52,962) [
17] or pLKO5.sgRNA.EFS.tRFP657 vector (#57,824) [
18], both sourced from Addgene. For the stable expression of puromycin-resistant sgRNAs, RUNX1-ETO9a-Cas9
+ cells were transduced with the sgRNAs and were subsequently selected using puromycin (1 μg/ml) in RPMI-1640 medium with 10% FBS, 1% PS, and 1 ng/ml IL-3. The sequences for the non-targeting (NT) control and sgRNAs targeting mouse
Runx1 are provided below: NT: 5′ cgcttccgcggcccgttcaa 3′, sg
Runx1-(1): 5′ tgcgcactagctcgccaggg 3′, sg
Runx1-(2): 5’ agaactgagaaatgctaccg 3′.
Transplantation assay
5-FU (150 mg/kg, intraperitoneal injection) was administered to male mice carrying the Cas9 gene and Trp53−/−-Cas9 mice. The bone marrow was collected from the Cas9 mice and Trp53−/−-Cas9 mice after 4 days, and were pre-cultured in RPMI-1640 containing 10% FBS, 1% PS, supplemented with 100 ng/ml murine SCF, 1 ng/ml IL-3 and 10 ng/ml IL-6 for 16 h. These cells were then transduced with RUNX1-ETO9a retrovirus and transplanted into lethally irradiated (9.5 Gy) 8 weeks-old male Ly5.1 mice. Each mouse received 2 × 105 RUNX1-ETO9a-transduced cells with 2 × 105 wild type Ly5.1 bone marrow cells. For serial transplantation, 1 × 106 spleen or bone marrow cells collected from moribund leukemic mice were intravenously injected into sublethally irradiated (5.25 Gy) male Ly5.1 mice. Note that male mice were used as recipient mice in all experiments to avoid a potential immune response of female mice to male donor cells.
Flow Cytometry
Fluoro-conjugated antibodies were used to stain cells for 15 min at 4 °C. Following staining, cells underwent two cold PBS washes and were then resuspended in PBS containing 2% FBS. Subsequently, analysis of the cells was conducted using Canto II (BD Biosciences, San Jose, CA, USA) and FlowJo software (FlowJo). The antibodies employed in this study are listed below: APC-CD90.1 (Thy1.1), Biolegend; #202,526, BV421-c-kit, Biolegend; #135,123, PE-Cy5-CD11b, Biolegend; # 101,210 and PE-Gr-1, Biolegend; # 127,608. The dilution ratio of these antibodies was 1:400.
Western blotting
Cells underwent multiple washes with PBS and were then lysed using pre-heated Laemmli sample buffer (Bio-rad, USA; #1,610,737). The resulting total cell lysates were subjected to SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Bio-Rad). The membrane was incubated with anti-RUNX1 antibody [AML1 (D4A6) Rabbit mAb #8529; Cell Signaling Technology, Beverly, MA, 1:500] and anti-GAPDH antibody [GAPDH (D16H11) XP® Rabbit mAb #5174; Cell Signaling Technology, Beverly, MA, 1:500]. Signals were detected using ECL Western Blotting Substrate (Promega, Madison, WI, USA) and visualized with the LAS‐4000 Luminescent Image Analyzer (FUJIFILM).
Cell growth assay
The cytotoxic effects of DS-5272, Cytarabine, Dexamethasone, and Decitabine against RUNX1-ETO9a cells with/without Trp53 deficiency or cSAM cells were assessed using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) following the manufacturer's instructions. Cells were plated in 96-well plates at a density of 5 × 103 cells/well in 0.1 ml medium and treated with various concentrations of each compound. After 72 h of incubation at 37 °C, 8 μl of the Cell Counting Kit-8 was added to each well. Following a 1-h incubation at 37 °C, the absorbance at 450 nm was measured using a microplate reader (CLARIOstar Plus, BMG LABTECH, Ortenberg, GER). Relative cell viability was expressed as the ratio of the absorbance in each treatment group to that of the corresponding untreated control group. The data are presented as means ± standard deviation (SD) from more than three independent experiments. IC50 values were calculated using GraphPad Prism software.
Statistical analyses
GraphPad Prism 10 was employed for all statistical analyses. Pairwise comparisons of significance were carried out utilizing ordinary two-way ANOVA. Survival curve comparisons were performed using the log-rank (Mantel-Cox) test. Animal experiments were not subjected to blinding or randomization. Sample sizes were determined based on prior experience rather than a predetermined statistical method. All data are presented as mean ± SD.
Discussion
Although t(8;21) AML has been classified as a favorable risk AML, a significant proportion of patients, especially those with specific co-operating mutations, often relapse and eventually die.
TP53 is one of the genes whose mutations are associated with poor prognosis in t(8;21) AML [
5]. In this study, we established a novel murine model for t(8;21) AML with/without
Trp53 deficiency using RUNX1-ETO9a, a short isoform of RUNX1-ETO with stronger leukemogenic potential [
9]. The RUNX1-ETO9a cells are able to generate AML in vivo and can be cultured in vitro for up to three weeks. In addition, the RUNX1-ETO9a cells established in this study express Cas9. Therefore, any gene of interest can be efficiently depleted in these cells.
Previous experimental studies have shown that loss of TP53 promotes disease progression and therapy resistance in RUNX1-ETO leukemia [
7,
8]. Consistent with these findings, we showed that
Trp53 deficiency accelerates the development of AML driven by RUNX1-ETO9a. However, it should be noted that
Trp53 was already deleted in cells prior to RUNX1-ETO9a transduction in all these
Trp53-deficient t(8;21) AML models. Given that
TP53 mutations are typically detected as secondary somatic mutations in t(8;21) AML, and that acute and chronic inhibition of TP53 sometimes show opposing effects [
27], the effect of late
Trp53 depletion in the established RUNX1-ETO9a leukemia warrants further investigation. The Cas9
+RUNX1-ETO9a cells established in this study will be useful for this purpose. Furthermore, our mouse t(8;21) AML models will provide ideal platforms to perform the in vivo CRISPR/Cas9 library screening to identify key regulators that promote or suppress the development of RUNX1-ETO leukemia, particularly in vivo.
Using these RUNX1-ETO9a cells with or without
Trp53 deficiency, we showed that targeting RUNX1 is only effective in
Trp53-intact RUNX1-ETO9a cells. Previous studies have shown that RUNX1 has a dual role in leukemogenesis [
28]. RUNX1 acts as a tumor promoter by promoting the survival of AML cells [
20,
21], in part through activation of TP53-mediated pro-apoptotic signaling [
19,
29]. On the other hand, RUNX1 also acts as a tumor suppressor by inhibiting myeloid maturation [
20,
30]. Therefore, it is likely that the tumor suppressor role of RUNX1 is more pronounced in the
Trp53-deficient RUNX1-ETO cells. Thus, our data together with previous findings strongly suggest that the antileukemic effect mediated by RUNX1 depletion requires functional TP53.
Various novel therapeutic strategies for treating RUNX1-ETO leukemia have demonstrated promise in either clinical or experimental investigations [
1]. These include a KIT inhibitor dasatinib [
31], JAK inhibitors [
15,
32], HDAC inhibitors [
33], and glucocorticoid drugs such as dexamethasone. In this study, we found that RUNX1-ETO9a cells were particularly sensitive to dexamethasone regardless of
Trp53 status. While glucocorticoids are widely used to treat lymphoid malignancies [
26], they are generally not deemed beneficial in the context of AML. However, several previous reports have repeatedly shown that glucocorticoids are effective in suppressing the growth of t(8;21) AML cells at low doses, but not in other subtypes of AML [
34,
35]. These findings, together with our data, provide a rational basis for clinical testing of glucocorticoid drugs, such as dexamethasone, against t(8;21) AML including those with
TP53 alterations.
In summary, we established novel murine Cas9+ RUNX1-ETO9a cells with intact or deficient Trp53. These cells allow testing the effect of novel drugs in vitro and in vivo, enable genetic screens using sgRNA libraries, and will provide valuable information on the role of TP53 in the development of t(8;21) AML in future studies.
Acknowledgements
We thank the Flow Cytometry Core and the Mouse Core at The Institute of Medical Science, The University of Tokyo. This work was supported by Grant-in-Aid for Scientific Research (B) (22H03100, SG), Grant-in-Aid for Scientific Research on Innovative Areas (Research in a proposed research area) (21H00274, SG), Research grant from The Japanese Society of Hematology (SG), AMED under Grant Number (22ck0106644s0202 and 23ama221514h0002, SG), JSPS KAKENHI Grant Number JP22K16319 (KY), AMED under Grant Number JP23ama221223 (KY) and Kobayashi Foundation for Cancer Research (KY).
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.