Introduction
Osteoporosis (OP) is a metabolic disease, which is characterized by decreased bone density and damaged bone microstructure [
1]. Postmenopausal women comprise about 1/3 of the 8.3 million people in China suffering from OP [
2]. OP is a complex systemic disease resulting from genetic and environmental factors interacting. Biochemical markers of bone turnover (BTMs) are commonly used for therapy monitoring purposes for osteoporotic patients [
3]. Currently, more than 400 gene loci associated with osteoporosis have been found [
4,
5]. Among them, the effects of SNP of LRP5 and LRP6 genes on OP have attracted much attention. A study showed that LRP6 polymorphism may be associated with body composition and BMD in Iranian children [
6]. Another study showed that there is a modest effect of the LRP5 rs3736228 C > T on the increased susceptibility of osteoporosis [
7]. Moreover, the study [
8] found that bone mass and bone strength decreased with age, indicating that age played an important role in BMD. In addition, estrogen is one of the important factors affecting OP, postmenopausal hormonal modification negatively impacts the quality of the bone [
9]. Several studies have shown that with the increase in menopausal years, the risk of osteoporosis increases [
10‐
12]. In our previous study, we investigated that the polymorphism of LRP5 gene was related to the decrease in BMD in postmenopausal women [
13]. In order to further explore LRP5-/6 gene polymorphisms and its association with risk of abnormal bone mass in postmenopausal women, we performed a case–control study to investigate the role of LRP5-/6 gene–gene, gene-age and gene-menopausal years interactions on the risk of ABM in postmenopausal women.
Materials and methods
Study subjects
A total of 166 ABM patients and 106 age-matched healthy controls were included in this study. Patients with ABM were consecutively enrolled from the First Affiliated Hospital of Shihezi University School of Medicine between December 2018 and December 2019. The diagnostic criteria for OP refer to guidelines established by WHO in 1994 [
14]. The controls were also registered from the same hospital during the same period. Based on the results of BMD, the study subjects were divided into the control group (normal bone mass group) and the ABM group (T-score ≤ -2.5SD for OP, − 2.5SD < T score < -1.0SD represents reduced bone mass; if T score < -1.0SD, represents abnormal bone mass (ABM). Inclusion criteria. (1) Women who have been in natural menopause for more than one year; (2) Ages 47 to 80 years; (3) All the participants were Han nationality living in Xinjiang Uygur Autonomous Region, without any genetic relationship, and had a complete medical history. Exclusion criteria: autoimmune diseases, thyroid, and parathyroid diseases, severe cardiac, hepatic, and renal diseases, and malignant tumors with underlying diseases affecting Ca and other bone metabolic indexes. This study was performed by the ethical guidelines of the Helsinki Declaration of 1975 (revised in 2008). It was approved by the Ethics Committee of the First Affiliated Hospital of Shihezi University School of Medicine (ethics number:2019–129-01). All participants signed informed consent forms.
Observation indicators
General descriptive data of the subjects: age, menopausal years, body mass index (BMI), and waist-to-hip ratio (WHR) of the included study subjects were collected and analyzed. The concentrations of peripheral serum calcium (Ca), phosphorus (P), and alkaline phosphatase (ALP) were measured by Roche automatic biochemical analyzer (Model Modular DPPH7600).
BMD of the lumbar spine 1–4 (L1-4) and femoral neck (FN) was measured by dual-energy X-ray (DEXA).
Genotyping
Genomic DNA was extracted from the peripheral blood of the participants using the DNeasy Blood & Tissue Kit(Thermo Fisher Scientific (China) Equipment Co) and stored at − 80 °C for future experiments. The Agena Mass ARRAY system was used for SNP genotyping. The primers for each locus are shown in Table
1.
Table 1
Primers and PCR products
LRP5-rs41494349 | CCGCAGTGGACTTCCAGTTT | 88 |
| CGTCTGGTTCAGGTAGGTCG | |
LRP5-rs2306862 | AGTTTGGCCTTGACTACCCC | 95 |
| GCGCCACTTCGATTCTTTGG | |
LRP6-rs10743980 | CCCTTATCCGAACTGAAAACACC | 71 |
| GGATTTCTTTCTGCAGGATGGC | |
LRP6-rs2302685 | TGAGGAGAGTCTCAGAAGCCA | 80 |
| TCGAGCCTTGTGCTAAACCC | |
Statistical analysis
Statistical analyses were performed using the SPSS 22.0 software. K-S method was used to test the normality of all data. The measurement data that do not conform to the normal distribution were expressed by quartiles, and rank sum test was used for comparison between two groups. The χ2 test was used to determine whether the LRP5 and LRP6 genes conformed to the Hardy–Weinberg equilibrium and the frequency of genotype and gene distribution between groups. Logistic regression analysis was used to analyze the association between gene polymorphism and ABM susceptibility. Multidimensional dimension reduction (MDR) was used to establish models and detect gene–gene, gene-age, and gene-menopausal years interactions. The linkage disequilibrium structure was constructed by SHEsis software, and the genetic association was examined at haplotype level. All tests were bilateral inspections, and a value of P < 0.05 was considered statistically significant.
Discussion
Postmenopausal osteoporosis is a long-term, progressive disease associated with a high risk of fractures, which seriously threatens people's health [
15]. Currently, the most common prescription agent for postmenopausal osteoporosis is Denosuma, which reduces the frequency of non-vertebral fractures and increases bone formation [
16,
17].
Wnt signaling pathway is one of the important signaling pathways to regulate bone metabolism [
18]. LRP5-/6 receptor protein inhibits bone resorption and promotes bone formation by binding to downstream β-catenin [
19], the mutation of LRP5-/6 gene leads to the loss of control of Wnt signal pathway, which affects bone metabolism [
20,
21]. OP is not only influenced by genetic factors but also by other factors, such as age and menopause age [
22,
23]. However, the pathogenesis of OP cannot be entirely explained by any of the genetic variables that have been found, therefore genetic interaction and gene-age/menopausal years interaction may be another significant cause of the disease.
In the present study, it was found that the risk of ABM in CT and CT/TT genotypes of LRP5 gene at rs2306862 locus was higher than that in CC genotype, indicating that the mutation of allele T increases the risk of ABM. At the rs2302685 locus of LRP6 gene, the risk of ABM in TC genotype was higher than that in TT genotype, indicating that the mutation of allele C increases the risk of ABM. AI et al. [
24] found that uncommon loss-of-function mutations facilitate DKK1 competitive binding to the LRP5-/6 receptor in the LRP5 gene, which prevented Wnt/-catenin signaling. Riancho et al. [
25] discovered that the polymorphisms at the LRP6 gene locus rs2302685 and rs11054704 were responsible for the decline in BMD in postmenopausal women in Europe. Additionally, Kokubu et al. [
26] discovered that people with the CC genotype of the LRP6 gene rs2302685 loci had intercrural BMD that was considerably greater than those with the TT/CT genotype. Animal experiments also revealed that LRP5-/6 are functionally overlapping homologous receptors. In mouse embryonic development, both proteins stimulate postnatal bone acquisition via Wnt signaling stimulates postnatal bone acquisition [
27,
28], and LRP6-/- mice were born to die at birth due to mesial skeletal and limb defects, whereas adult LRP5-/- mice result in OP [
29]. This conclusion was in line with the present literature reports.
In the present study, we found that the
Dʹ value between LRP5-rs41494349 and rs2306862 was more than 0.8; it showed a strong chain reaction. Thus, we also conducted haplotype analysis between rs41494349 and rs2306862. The results indicated that the haplotype containing the AC and AT haplotypes was associated with an increased OP risk. Kitjaroentham A et al. [
30] found that the risk of osteopenia/osteoporosis was not correlated with either the rs41494349 or the rs2306862 SNPs. This contradicts our findings, and it may be due to the complex interactions between genes, which require further analysis. There was also a strong linkage disequilibrium between the two SNPs at the LRP6- rs10743980 and rs2302685, but haplotype analysis did not show a difference in haplotype frequency distribution between the two groups. This may be because different haplotype interactions can result in different phenotypic effects, which need further analysis.
At the same time, we investigated the interaction of each LRP5-/6 gene locus and found that the polymorphisms of rs2306862&rs10743980, rs41494349&rs2302685 & rs10743980 gene SNP were synergistic with the development of ABM and were risk factors for the development of ABM. Animal studies have shown that mice carrying both LRP5 and LRP6 heterozygous mutations could reduce BMD and cause limb deformities [
31]. Van Meurs et al. [
32] found that LRP5 and LRP6 genes played a role in bone metabolism and fracture. These findings imply that genetic variations may influence the occurrence of OP. Age and the polymorphisms at the rs2306862, rs2302685, rs41494349, rs2302685, and rs10743980 SNPs were risk factors for the development of ABM. It is generally known that being older is a risk factor in and of itself for the onset of OP and that OP prevalence rises yearly with age. However, this study did not find a correlation between the risk of ABM and menopausal years, which may be due to the following factors: (1) OP activation of Wnt/β catenin signaling was accompanied by stress activation of the OPG/RANK/RANKL-related osteoblast pathway, which compensatively stimulated osteoblast formation; (2) Different SNPs on the same gene responded differently to environmental factors.
Several limitations of this study should be considered: (1) More studies are needed to confirm our results, especially in larger and different ethnic groups; (2) The study should include more SNPs of LRP5 and LRP6 genes; (3) The mechanisms affecting the reduction of BMD are complex, and more environmental factors affecting BMD should be included in the further study.
Research on the occurrence of ABM has received considerable attention in recent years, our research will increase understanding of the etiology of OP and provide a theoretical basis for the pathogenesis of OP.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.