Introduction
Postmenopausal Osteoporosis (PMOP) is a popular systemic chronic metabolic disease that poses a serious threat to women’s health around the world [
1]. PMOP is more common in women 5–10 years after menopause and is due to decreased PM estrogen that accelerates osteoclast formation and bone resorption [
2‐
4]. While the imbalance of bone resorption and formation leads to decreased bone mineral density (BMD) and bone microstructure destruction [
5]. Early PMOP is hard to be detected and no distinct symptoms are presented before the fracture [
6]. The treatment and prevention of osteoporotic fractures, which result in increased disability, mortality, and health care costs, have important clinical and public health implications [
7‐
10]. Presently, detailed molecular mechanisms and treatment strategies of PMOP remain uncertain.
As reported, the dysfunction of bone marrow mesenchymal stem cells (BMSCs) is the crux of OP [
11]. The differentiation of mesenchymal stem cells into osteoblasts and the differentiation of circulating monocytes into osteoclasts exert a crucial role in bone metabolic balance [
12]. Studies have elaborated that BMSCs are linked with decreased osteogenesis and elevated oxidative stress [
13]. BMSCs become a hot topic in bone regeneration research because of their excellent osteogenic potential and abundant sources, but their clinical application is restrained because of elevated cost and decreased efficiency [
14]. It is of momentous value to explore the molecular mechanism of BMSCs differentiation for PMOP cure.
Long non-coding RNA (lncRNA), a conserved specific non-coding RNA, participates in multiple biological processes covering signal transduction and cell growth, etc. [
15]. As reported, LncRNAs are implicated in BMSCs differentiation [
16]. For instance, lncRNA MEG3 restrains the osteogenic differentiation (OD) of BMSCs in PMOP via targeting microRNA (miR)-133a-3p [
17]. LncRNA Homeobox D gene cluster antisense growth-associated long noncoding RNA (HAGLR) has been testified to exert a crucial role in femoral neck fracture healing [
18]. Nevertheless, its action in PMOP is uncertain.
Several mechanisms for lncRNA regulation have been characterized, including histone modification [
19], transcription factor regulation [
20], alternative splicing [
21], and competing endogenous RNA (ceRNA) of miRNAs [
22,
23]. By sponging miRNAs, lncRNAs protect corresponding mRNAs from being silenced. miRNAs, a set of short non-coding RNAs, modulate biological processes such as cell differentiation [
24]. miRNAs regulate gene expression at the post-transcriptional level by inhibiting the translation of messenger RNA (mRNA) or accelerating the degradation of mRNA, thereby regulating many physiological and pathological processes [
25]. miRNAs are implicated in PMOP and are regarded as latent curative targets [
26]. For instance, miR-218-5p alleviates PMOP via accelerating osteoblast differentiation of BMSCs [
27]. Bioinformation website analysis found that miR-182-5p was the downstream target of HAGLR. MiR-182-5p, a member of the miR-183/96/182 cluster, has been reported as a tumor oncogene or suppressor gene in diversified cancers [
28]. Nevertheless, no research has illuminated its action in PMOP.
The study was to explore the action and molecular mechanism of HAGLR in PMOP. The research results uncovered that HAGLR regulates the differentiation of BMSCs via the miR-182-5p/Homeobox protein A10 (Hoxa10) axis, thereby influencing PMOP progression.
Materials and methods
Clinical samples
PMOP patients (n = 55) and healthy PM women (n = 55) in The Affiliated Lianyungang Oriental Hospital of Xuzhou Medical University were enrolled, and peripheral blood samples were collected. Lumbar spine bone mineral density (L1-L4) was assessed according to standard operating instructions using a dual-energy X-ray bone densimeter (DXA) (Hologic Discovery Wi, Hologic, USA). T-score is the standard deviation of bone mineral density relative to the mean. Osteoporosis is defined as bone mineral density of the lumbar spine (L1-L4) with a T-score ≤ -2.5. The inclusion criteria are as follows: (1) age ≥ 50 years; (2) Menopause ≥ 1 year; (3) Sign informed consent before participating in the study. Exclusion criteria are as follows: (1) any comorbidities that may significantly affect bone metabolisms, such as thyroid disease, diabetes, cancer, kidney disease, or ankylosing spondylitis; (2) previous anti-osteoporosis medication or hormone therapy (vitamin D and/or calcium supplements are allowed), such as estrogen or glucocorticoids; (3) A history of smoking or alcohol dependence within the past year. The research was approved by the Ethics Committee of The Affiliated Lianyungang Oriental Hospital of Xuzhou Medical University.
Isolation, culture, and induction of BMSCs
Bone marrow was obtained from mice (Guangdong Medical Laboratory Animal Center, Guangdong, China). BMSCs were isolated by the whole bone marrow adhesion method and cultured in a-MEM medium (HyClone) containing 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin (HyClone). After passages, BMSCs were identified by flow cytometry to detect surface markers CD34, CD45, CD73, and CD90.
BMSCs were cultured in 6-well plates and added an osteogenic induction medium containing Dulbecco’s Modified Eagle Medium, 10% FBS, 0.1 mg/mL dexamethasone, 50 mg/mL ascorbic acid, and 10 mmol/L glycerophosphate. The medium was replaced every 3 days.
Cell culture and transfection
MiR-182-5p, anti-miR-182-5p, sh-HAGLR/Hoxa10, and their respective negative controls (NCs) were provided by GenePharma (Shanghai, China). Transfection of BMSCs was done with Lipofectamine 3000 reagent (L3000015, Invitrogen) in the light of the manufacturer’s instructions. AD-HAGLR-EGFP and NC adenovirus (AD-EGFP) were produced by Han Biotechnology (Shanghai, China).
Alizarin red S staining
When the confluence of BMSCs reached about 100%, osteogenic differentiation was induced by adding osteogenic induction medium. After 14 days,cells were fixed with 95% cold ethanol for 25 min and air-dried. Alizarin Red S (40 mmol/L; A5533, Sigma Aldrich, USA) was dissolved in dH
2O, and cells were stained with the prepared solution at 25℃ for 30 min. Then, 10% (w/v) cetylpyridine chloride (HC0502, HEROCHEM, Shanghai, China) was prepared and used for decolorization. The absorbance at 560 nm was read [
29].
Alkaline phosphatase (ALP) staining
Osteoblasts were detached with trypsin and seeded in a 24-well plate. Then, cells were treated with propanol (15 min), incubation solution (6 h), cobalt nitrate (15 min), and ammonium sulfide (5 min) (all 200 μL). Optical density at 490 nm was read on a microplate reader (Varioskan LUX; Thermo Fisher Scientific) [
30].
Flow cytometry
To assess cell apoptosis, 2 mL cell suspension at 1 × 10
5 cells/mL was seeded into a 6-well plate. After 72 h, cells were centrifuged at 1000 rpm for 3 min and tested by an Apoptosis Detection Kit (559763, BD Biosciences, USA). Cell staining was done using Fluorescein isothiocyanate-Annexin V and propidium iodide, and analysis of cell apoptosis was performed using flow cytometry (BD Biosciences). Cell QuestPro software (BD Biosciences) was used for apoptosis analysis [
31].
Construction of the PMOP mouse model
Fifty Balb/c mice were randomly divided into the ovariectomized model (OVX) and the sham operation control (sham) groups. The OVX mice were anesthetized with 5% ketamine and sterilized normally. The ovaries on both sides of the mice were removed in a biologically clean environment. After complete hemostasis, the abdominal wound was sutured. Only a small amount of fat was removed in sham surgery. Two groups of mice were fed separately with free food and water. All experiments on mice met the standard guidelines for the use of animals in scientific research.
PMOP mouse grouping
Four weeks after ovariectomy, PMOP mice were injected with AD-HAGLR-EGFP, NC adenovirus (AD-EGFP), and sh-Hoxa10. On days 1 to 3 of weeks 1 and 4, mice (n = 8) were administered at a dose of 7 mg/kg via the caudal vein. PMOP mice injected with normal saline were regarded as controls (PMOP; n = 8). Six weeks after the first injection, the bilateral femurs were collected from mice.
Analysis of BMD and biomechanical parameters
BMD levels in the left femur of mice were measured using a Lunar DPX-IQ dual-energy X-ray absorptiometry with a PIXImus II absorptiometry (Lunar Corporation, Madison, WI). Elastic modulus, maximum load, and maximum bending stress were tested according to the requirements of the three-point bending test using a computer-controlled mechanical testing machine (SANS-10404043, Shenzhen, China). The sample distance is 23 mm and the plunger speed is 2.0 mm/min [
32].
Hematoxylin and Eosin (HE) staining
Tibias of mice were fixed with paraformaldehyde (P0099, Beyotime Biotechnology, China) for 1 week and rinsed 3 times to remove excess paraformaldehyde. Tibias were embedded in paraffin and cut into 5 μm sections, followed by treatments with xylene and graded ethanol. HE staining was performed using Hematoxylin and Eosin (G1120, Solarbio, China) according to the manufacturer's instructions. The morphology of the tibias was observed under a microscope. HE staining was performed on the left hind leg, and the mice in each group were examined on the same side [
33].
To test cell apoptosis, the tissues were treated with 2-methoxyethyl acetate and then incubated in 10 mM citrate buffer (pH 6.3) at 90℃ for 15 min. Subsequently, the sections were incubated with 0.5% pepsin at 37℃ for 30 min and detected by an in situ cell death detection kit (12,156,792,910, Roche, USA). Sections were stained with diaminobenzidine (Sigma) after incubation with POD at 37℃ for 1 h and then examined under a light microscope. TUNEL-positive cells were counted in 5 random fields [
34].
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from tissues or cells using TRIzol (15,596,026, Invitrogen) and reverse-transcribed using the PrimeScript RT Master Mix kit (RR036B, Takara, Dalian, China) according to the manufacturer's recommended instructions. Then, RT-qPCR was performed in the ABI Prism 7900HT sequence detection system (Applied Biosystems) using SYBR Green Real Time PCR Master Mix (QPK-201, Toyobo, Osaka, Japan). Gene quantification was performed using the 2
−ΔΔCT method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were used as loading controls, respectively. The primer sequences for RT-qPCR were presented in Table
1 [
35]. The agarose gel images are presented in the supplementary Fig. 1.
Table 1
RT-qPCR primer sequence
HAGLR | Human | AGAAGTCTCGGGAACCTCCA | ACAGTGTGTTACCGCAGGAG |
| Mouse | CCACGCTAGGAGTGAGTGTG | AAGTGTCAGGTTGGGGGTTC |
Hoxa10 | Human | AGAGATTAGCCGCAGCGTCC | TTCCTGGGCAGAGCCTGAAG |
| Mouse | AGAGATTAGCCGCAGCGTCC | TTCCTGGGCAGAGCCTGAAG |
OPN | Human | GATGGCCGAGGTGATAGTGT | GTGGGTTTCAGCACTCTGGT |
OCN | Human | GGCAGCGAGGTAGTGAAGAG | CTAGACCGGGCCGTAGAAG |
Runx2 | Human | GAATGCACTACCCAGCCAC | TGGCAGGTACGTGTGGTAG |
GAPDH | Human | CACCCACTCCTCCACCTTTG | CCACCACCCTGTTGCTGTAG |
| Mouse | CATCAACGGGAAGCCCATC | CTCGTGGTTCACACCCATC |
miR-182-5p | Human | CGGACTTTGGCAATGGTAGAACT | GCAGGGTCCGAGGTATTC |
U6 | Human | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Western blot analysis
Radioimmunoprecipitation assay lysis buffer (P0013B, Beyotime) was added to extract the total protein. Subsequently, proteins were separated by electrophoresis and electroblotted onto polyvinylidene fluoride membranes (Millipore). After incubation with 5% skim milk for 2 h, the membrane was reacted overnight with primary antibodies Hoxa10 (ab191470), Runt-related transcription factor 2 (RUNX2) (ab76956), osteopontin (OPN) (ab214050) (1: 1000), Osteocalcin (OCN) (ab93876, 1: 500) and GAPDH (ab8245, 1: 2000, Abcam). Membranes were incubated with the corresponding secondary antibody for 2 h and exposed to enhanced electrochemiluminescence (Thermo Fisher Science) to develop protein bands. Data analysis was performed using Image J software (NIH, Bethesda) [
36].
RNA immunoprecipitation (RIP) test
BMSCs were transfected with pMS2bp-GFP and MS2, MS2-HAGLR, or MS2-mutant (MUT)-HAGLR and collected after 48 h. Biotin-conjugated RNA complexes were pulled down and checked for RIP according to the manufacturer's instructions using the Magna RIP kit (Millipore, USA). Samples were incubated with anti-GFP and anti-immunoglobulin G, and miR-182-5p expression was detected by RT-qPCR [
37].
RNA pull-down test
BMSCs were transfected with biotinylated miR-182-5p and HAGLR. After 72 h, BMSCs were collected, and cell lysates were bound to M-280 streptavidin magnetic beads (Sigma) to pull down the biotin-conjugated RNA complexes. Then, the RNA-bound beads were purified with TRIzol. HAGLR or miR-182-5p expression was tested by RT-qPCR.
Determination of luciferase activity
Wild-type (WT) or MUT HAGLR binding to miR-182-5p was subcloned into the pGL3 vector. BMSCs were co-transfected with miR-182-5p (RiboBio, Guangzhou, China) and 10 μg of pur-WT-HAGLR or pur-MUT-HAGLR. WT or MUT Hoxa10 and miR-182-5p were subcloned into a pGL3-based vector (Promega). miR-182-5p (RiboBio) was co-transfected with 10 μg pluco-WT-Hoxa10 or pluco-MUT-Hoxa10. After transfection of 48 h, a test of luciferase activity was done via the dual luciferase detection system (Promega Corporation, Fitchburg, WI, USA) [
38].
Statistical analysis
Data analysis was performed using SPSS 21.0 (SPSS, Inc, Chicago, IL, USA) statistical software. After the Kolmogorov–Smirnov test, the data were normally distributed, and the results were expressed as mean ± standard deviation (SD). Two-group comparisons were done with t test and comparisons among multiple groups were done with one-way analysis of variance (ANOVA) and Fisher’s least significant difference t-test. The enumeration data were expressed as rates or percentages, and the chi-square test was used for comparative analysis. P was a two-sided test, and P < 0.05 was accepted as indicative of distinct differences.
Discussion
BMSCs are multifunctional cells, being available to differentiate into osteogenic, adipogenic, and chondrogenic directions [
39]. BMSC activity is nearly associated with PMOP occurrence and progression [
40]. Consequently, it was crucial to understand the mechanism of BMSC OD for the development of novel PMOP treatment strategies. LncRNA, a critical gene regulator, is linked with multiple bone diseases. In this research, HAGLR was decreased in PMOP patients’ peripheral blood, illuminating that HAGLR might be implicated in PMOP. Additionally, HAGLR was gradually elevated during BMSC OD. Repression of HAGLR restrained the OD of BMSCs in
vitro, while augmented HAGLR oppositely acted. In the meantime, elevated HAGLR suppressed PMOP progression in
vivo. These results elaborated that augmented HAGLR suppressed PMOP via ameliorating BMSC proliferation and OD.
BMSCs exerted a crucial action in PMOP progression. Differentiation of BMSCs into osteoblasts was critical for maintaining normal BMD and modulating bone formation [
41]. Numerous studies have elucidated that lncRNA participates in mediating BMSC differentiation. For instance, lncRNA HOTAIR is augmented in the serum of OP patients and suppresses BMSC OD via modulating the Wnt/β-catenin pathway [
42]. LncRNA H19 is decreased in PMOP, while augmented H19 restrains BMSC proliferation and OD via silencing miR-19b-3p [
43]. HAGLR is HOXD antisense growth-associated LncRNA, which has been testified to be associated with diversified diseases, covering cancer [
44], neurodegenerative diseases [
45], heart disease [
46], and bone disease [
47]. Suppression of HAGLR constrains the healing of femoral neck fractures via suppressing osteoblast growth. In this research, HAGLR was decreased in PMOP tissues, and elevated HAGLR boosted BMSC proliferation and OD in
vivo and in
vitro. These findings manifested that HAGLR might perform as the latent target for PMOP therapy.
Typically, LncRNA prevalently performs as a sponge of miRNA to modulate protein translation and cell activity [
48]. In tibial fractures, HAGLR exerts a protective role by serving as a sponge of miR-214-3p to boost BMP2. In this study, miR-182-5p was elevated in PMOP and negatively linked with HAGLR. HAGLR had a targeting relationship with miR-182-5p in PMOP. miR-182-5p has been discovered to be elevated in OP patients’ femur tissue, while decreased miR-182-5p activates the Rap1/MAPK pathway via targeting ADCY6, thereby boosting the differentiation of osteoblasts [
49]. Additionally, elevated miR-182-5p restrains chondrogenic differentiation of BMSCs via silencing parathyroid hormone-like hormone [
50]. Nevertheless, decreased miR-182-5p turned around the effects of silenced HAGLR on BMSCs, and boosted the OD of BMSCs. Additionally, miR-182-5p negatively modulated Hoxa10 to restrain BMSC OD.
Hoxa10 is a transcription factor covering a homeobox and belongs to the HOX family, which is a crucial regulator of the osteogenic process and is available to control osteoblast production via immediately activating bone regulatory and phenotypic genes [
51]. Recently, studies have shown that the OD of Hoxa10 and BMSCs is elevated in osteogenic induction and is regulated by miRNAs. Enhanced HOXA10 improves the OD of BMSCs [
52]. In this research, Hoxa10 was gradually elevated during BMSC OD, while repression of Hoxa10 turned around the action of augmented HAGLR or silenced miR-182-5p on BMSC OD.
Admittedly, this study has some limitations. After testing, HAGLR in the peripheral blood of PMOP patients is reduced, but the association of HAGLR and PMOP should be verified by a large number of people, which provides a reliable molecular biomarker for PMOP diagnosis.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.