Background
Osteosarcoma is a rare tumor of mesenchymal origin characterized by the production of osteoid (immature bone) by malignant cells [
1‐
3], mainly in individuals > 60 years old and between 10 and 19 years [
2‐
4]. Osteosarcoma metastasizes fast and has a high mortality rate [
1‐
4]. The relapse rate in patients with osteosarcoma is 30% with localized disease and 80% with metastatic disease, and the long-term survival in patients with recurrent disease is < 20% [
3]. Chemotherapy (mostly based on methotrexate, doxorubicin, and cisplatin (CDDP)) can improve the survival of osteosarcoma patients combined with surgery [
5,
6], but chemoresistance can affect the outcome of osteosarcoma [
7]. Therefore, exploring the mechanism of chemotherapy resistance in osteosarcoma is very important.
Exosomes (exo) play important roles in the transport of material (e.g., proteins, metabolites, and RNA) between cells [
8]. Active tumor cells secrete more exo into the tumor microenvironment than normal cells or dormant tumor cells would [
9]. Tumor cell-secreted exo can transform normal cells into tumor cells [
9]. Besides, exo contain bioactive molecules (including microRNAs (miRNAs) [
10]) and cytokines that regulate the signaling pathway of the recipient cells, further regulating the invasion, proliferation, and chemosensitivity of the tumor cells [
11]. miRNAs can target the 3’ untranslated region of their target mRNAs directly, suppressing mRNA translation into protein [
12], playing significant roles in multiple cellular pathways, and can regulate tumor cell invasion, proliferation, and chemosensitivity [
13‐
15]. Bone marrow mesenchymal stem cells (BMSCs)-derived exo can regulate osteosarcoma proliferation through the Hedgehog signaling pathway [
16]. In addition, drug-resistant osteosarcoma cells can transfer multiple drug-resistant phenotypes to non-drug-resistant cells via exo, thereby inducing drug resistance in previously non-drug-resistant osteosarcoma cells [
17]. It has been reported that miR-331-3p might lead to poor cancer outcomes in breast cancer [
18], but there are no studies on the association between miR-331-3p and osteosarcoma.
Autophagy is markedly associated with drug resistance in osteosarcoma [
19]. In autophagy, damaged organelles, mitochondria, and macromolecules are degraded, which plays important roles in cell growth, development, differentiation, and death [
20]. Various chemotherapy drugs can induce autophagy, and autophagy is correlated with drug resistance [
19,
21,
22]. Several chemotherapy drugs induce apoptosis in cancer cells, but the cancer cells can upregulate autophagy to escape apoptosis [
19].
Therefore, this study aimed to investigate the relationship between exo miR-331-3p and osteosarcoma and to explore whether miR-331-3p could regulate drug resistance via autophagy in osteosarcoma. The results could provide a better understanding of the role of miRNAs in osteosarcoma and the implications in clinical practice.
Methods
Osteosarcoma cells culture
The NHOst cell line (PX-2538RL, Lonza, USA) and osteosarcoma cell (OSC) lines MG63 (#CL-0157), HOS (#CL-0360), U2OS (#CL-0236), and Saos2 (#CL-0202) (OSCs were all from Procell Life Science & Technology, Co., Ltd., Wuhan, China) were purchased and cultured in minimal essential medium (MEM, PM150410, Pricella, Wuhan, China) containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin in a cell incubator at 37 ℃ and 5% CO2. The cells were re-suspended in 3 mL of medium and then subcultured in a petri dish at a 1:3 dilution.
Culture of cisplatin-resistant OSCs
CDDP-resistant OSCs were induced as previously described [
23]. When the MG63, HOS, U2OS, and Saos2 cells grew to the logarithmic phase, 0.1 mg/L CDDP (MB1055, Meilune, Dalian, China) was added to the culture medium. After 24 h, the culture medium was replaced with a medium lacking CDDP. Cell passage was performed after the stable growth of the cells. This method was repeated five times. The CDDP concentration was increased to 0.2 mg/L for a further five cycles and then to 0.5 mg/L for three cycles. After a total of 190 days of induction, OSCs could grow stably and passage normally in the presence of 0.5 mg/L CDDP, indicating that the cell line could tolerate 0.5 mg/L CDDP. The drug-resistant strain was named OSC/CDDP. After overnight cell culture, the medium was replaced with drug-containing medium at various concentrations: 0, 0.25 μg/mL, 0.5 μg/mL, 1 μg/mL, 2 μg/mL, 4 μg/mL, 8 μg/mL, 16 μg/mL, 32 μg/mL, and 64 μg/mL. The cells were then incubated at 37 degrees Celsius with 5% CO
2 for 72 h. MTT assay was performed, and the IC50 was calculated.
Transfection of miR-331 inhibitor
Prepared sufficient 1.5 mL EP tubes and mixed as follows: added 10 μL of Exo-Fect solution, 20 μL of miRNA inhibitor (20 μmol of miR-331-3p inhibitor, miR-NC inhibitor, Genepharma, Shanghai), 70 μL of sterile 1 × PBS, and 50 μL of sterile 1 × PBS re-suspended MG63/CDDP extracellular vesicles, totaling 150 μL of transfection reaction system. Placed the EP tubes in a 37 ℃ mixer and incubated for 10 min, then immediately placed on ice. Added 30 μL of ExoQuick-TC (EXFT10A-1, SBI, USA) provided in the kit to the transfection reaction system and inverted 6 times to mix. Placed the EP tubes on ice (or 4 ℃) and incubated for 30 min. Centrifuged at 13,000 rpm (5417R, Eppendorf, USA) for 3 min. Discarded the supernatant and rsuspended the precipitated transfected MG63/CDDP extracellular vesicles in 300 μL of 1 × PBS. Collected the transfected MG63/CDDP extracellular vesicles.
Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR)
A Direct Zol RNA microPrep kit (Zymo Research, Irvine, CA, USA) was used to extract the intracellular RNA and exo RNA. cDNA was synthesized using the PrimScript RT reagent kit with gDNA Eraser (#RR047A, Takara, Otsu, Japan) and the SYBR Premix Ex Taq (#RR820A, Takara, Otsu, Japan) from 200 ng of isolated RNA. The cDNA was used as the template in qRT-PCR reactions performed on an ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA). The sequences of primers are shown in Table
1.
Etarget was calculated as the amplification efficiency of the target gene,
Eref was the amplification efficiency of the reference gene, △and Ct was the difference between the Ct value of the control group and the sample. The formula is as follows:
$${\text{ratio}} = \frac{{(1 + E_{{{\text{target}}}} )^{{\Delta {\text{Ct}}_{{{\text{target}}}} \left( {{\text{control}} - {\text{sample}}} \right)}} }}{{(1 + E_{{{\text{ref}}}} )^{{\Delta {\text{Ct}}_{{{\text{ref}}}} \left( {{\text{control}} - {\text{sample}}} \right)}} }}$$
Table 1
Primers used for qRT-PCR
miR-331-3p | F | CACAACTCGAGAACGTACAGAAGGCTCCAGAAATG |
R | TGAAGATCTGAAGGATTAACCAACCAATTTTTGC |
miR-199a | F | ACACTCCAGCTGGGCCCAGTGTTCAGACTAC |
R | TGGTGTCGTGGAGTCG |
U6 | F | CTCGCTTCGGCAGCACA |
R | AACGCTTCACGAATTTGCGT |
Cell transfection
At 24 h before OSC transfection, the cells were digested with trypsin, their concentration was adjusted to 2 × 105 cells/mL, and the cells were inoculated into 6-well culture plates. After the cells adhered to the wells, they were cultured in 2 mL of Dulbecco’s modified Eagle’s medium (DMEM, PM150210, Pricella, Wuhan, China) containing serum but without antibiotics. For transfection, the mimics (miR-199a, GenePharma, Shanghai, China) were diluted with 200 μL Opti-MEM medium, mixed gently, and kept for 5 min at room temperature. At the same time, 5 μL of Lipofectamine 2000 was diluted with 200 μL of Opti-Mem I medium, mixed gently, and kept for 5 min at room temperature. The diluted mimics and Lipofectamine 2000 were mixed, kept for 25 min at room temperature, added into the cell culture well, and shaken to mix evenly. At 48 h after transfection, the expression level of miR-199a in the cells was detected using qRT-PCR.
Extraction and identification of exosome
OSCs were grown to 70–75% confluence, the original culture medium was discarded, and the cells were washed with PBS three times. Serum-free medium was added for further culture for 36–48 h. The culture medium was collected and centrifuged at 4 °C at 300 ×g for 10 min to remove the remaining cells, at 4 °C for 20 min at 2000 ×g to remove the cell fragments, and at 4 °C for 45 min at 11,000 ×g to remove the impurities. The supernatant was retained and then ultracentrifuged at 110,000 ×g at 4 ℃ for 90 min, and the supernatant was discarded. One milliliter of 1 × PBS was added to each centrifuge tube to resuspend the precipitate, and the suspension was transferred to a new ultracentrifuge tube and ultracentrifuged at 110,000 ×g at 4℃ for 70 min. The supernatant was discarded, and the precipitate (containing exo) was re-suspended in 100 μL of 1 × PBS. Transmission electron microscopy (JEM-2100, JEOL Ltd., Tokyo, Japan) of exo and granulometric analysis (ZETASIZER Nano series-Nano-ZS; Malvern Analytical, Malvern, UK) were performed. Exo were stained using anti-CD63 (#ab18235, Abcam, Cambridge, United Kingdom) and anti-CD81 (#ab239256, Abcam, Cambridge, UK) antibodies. The antibody dilution concentration was 1:1000. Flow cytometry (Accuri C6 flow cytomenter and BD FACSDiva, BD Biosciences, USA) was performed according to the instrument operation procedure.
PKH26-labeled exosomes
Exo (100 µL of an exo solution at 100 μg/mL) were suspended in 1 mL of PBS, and 4 μL of PKH26 fluorescent dye solution was added and incubated at 37 ℃ for 20 min. The solution was ultracentrifuged at 100,000 ×g for 70 min, and the supernatant was discarded. The exo were re-suspended in 10 mL of PBS and ultracentrifuged at 100,000 ×g at 4 ℃ for 70 min. The excess dye was removed, the supernatant was discarded, and the exo were suspended in 100 μL of PBS. The PKH26-labeled exo and OSCs were cultured together in MEM medium containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin in a cell incubator at 37℃ and 5% CO2 for 12 h. The medium was removed, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde, and stained with 4′,6-diamidino-2-phenylindole (DAPI). The cells stained red by PKH26 were observed under a confocal fluorescence microscope.
Transwell assay
Cy3-miR-199a mimic was transfected into OSC/CDDP cells. Then, OSC/CDDPs (1 × 106/well) and OSCs were co-cultured at a 1:1 ratio on a Transwell plate for 12 h. The upper compartment contained OSC/CDDPs, and the lower compartment contained OSCs. In the control group, only Cy3 was transfected without miR-199a. After rinsing the cells twice with PBS, the fluorescence of Cy3 in the OSCs was observed under a confocal microscope.
Verification of exosome function
Exo were extracted from drug-resistant OSC/CDDPs and from non-drug resistant. The OSCs were divided into three groups: the OSC treated with drug-resistant exo group (Exo/CDDP), the OSC treated with non-drug-resistant exo group (Exo/S), and the OSC treated with PBC blank control group (PBS + OSC). Exo (from drug-resistant or non-drug-resistant cells) (2 μg) were added to OSCs (1 × 106/well) to establish the experimental group. After co-culture for 12 h, CDDP (1, 10, 30, and 60 ng/mL) was added to the three groups, respectively, for 24 h, and then the cell activity was detected using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.
MTT assay
After CDDP treatment, 10 μL of MTT (Biosharp, Shanghai, China) was added to the cells in each well for 3 h. The α-MEM was removed from the wells, and 150 μL dimethyl sulfoxide was added to each well and shaken evenly. The absorbance of each well was measured at 570 nm using a Multiskan 51,119,000 microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).
Flow cytometry assay
CDDP (2 μM) was added to the OSC + PBS, Exo/S, Exo/CDDP, and OSC/CDDP cell groups. After incubation for 24 h, flow cytometry was performed. Triton X-100 (0.1%) was added to break the membrane of the cells, which were then centrifuged at 1000 rpm for 5 min. The cells were re-suspended in PBS and centrifuged at 1000 rpm for 5 min. An anti-microtubule-associated protein 1 light chain 3 alpha (LC3) antibody (#ab63817, Abcam, Cambridge, United Kingdom) was added (1:500, dissolved in 1% bovine serum albumin (BSA)) and incubated at room temperature for 2 h. After centrifugation at 1000 rpm for 5 min, the cells were re-suspended in PBS and centrifuged again at 1000 rpm for 5 min. In the dark, the goat anti-rabbit HRP-conjugated secondary antibody (1:2000, dissolved in 1% BSA, #ab6721, Abcam, Cambridge, United Kingdom) was added and incubated at room temperature for 1 h. The cells were centrifuged at 1000 rpm for 5 min, re-suspended in PBS, centrifuged again, and suspended in PBS for flow cytometry detection (Accuri C6 system, BD Biosciences, Franklin Lake, NJ, USA).
Verification of the functional miRNAs in exosomes
Since there were no expression differences of miR-199a between OSCs and OSCs/CDDP, miR-199a was used to identify the transmission of miRNA between OSC/CDDP and OSC. The cells were divided into three groups: OSC/CDDP + OSC (G1), OSC + OSC/CDDP + GW4869 (10 μM, cultured for 24 h; G2), and OSC (G3). In groups G1 and G2, the OSCs and OSCs/CDDP were co-cultured (1 × 106/well for OSC and OSC/CDDP), and the expression of miR-199a was detected using qRT-PCR. Then, by knocking out the Drosha expression of OSC/CDDP using a small interfering RNA (siRNA-Drosha), the activity of exo-miRNA was inhibited. The levels of miR-331-3p and miR-199a in exo were detected by qRT-PCR to determine whether miRNA loading into exo was inhibited by knocking out the Drosha protein. Then, the exo of OSC/CDDP were extracted and co-cultured with OSCs. The exo were divided into three groups: OSC + Exo/CDDP (treated with siRNA-Drosha), OSC + Exo/CDDP (not treated with siRNA-Drosha), and OSC + PBS. After 12 h of culture, 2 μ CDDP was added to each well, and the cells were subjected to MTT detection.
Western blotting
Cells or exo were lysed on ice using a radioimmunoprecipitation assay buffer containing protease inhibitors. Equal amounts of proteins from the different groups were separated using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto a 0.22-μm polyethylenedifluoride membrane. The membrane was incubated in 5% skim milk at room temperature for 1 h and then with primary antibodies at 4 ℃ overnight: LC3 (#ab63817, Abcam, Cambridge, United Kingdom), p62 (#ab91526, Abcam, Cambridge, United Kingdom), and β-actin (#ab8227, Abcam, Cambridge, United Kingdom). The next day, the membrane was washed with Tris-buffered saline-Tween 20 (TBST) and incubated with the goat anti-rabbit HRP-conjugated secondary antibody (#ab6721, Abcam, Cambridge, United Kingdom). The antibody dilution concentration was 1:1000. Immunoreactive protein bands were detected using an enhanced chemiluminescence kit. Photographs were taken using the Tanon 5200 chemiluminescence imaging system (Tanon, USA) and used ImageJ software (1.52a, NIH, USA) for analysis.
Statistical analysis
Each experiment was performed three times, and the results are shown as means ± standard deviations. Prism (8.0.2 Version, GraphPad Software, CA, USA) was used for statistical analysis. Differences among three or more groups were compared using a one‑way analysis of variance (ANOVA) and Tukey’s post hoc test. Two-sided P values < 0.05 were considered statistically significant.
Discussion
This study aimed to explore the mechanism of exosomal miR-331-3p in chemoresistance in osteosarcoma. The results suggest that exo secreted from chemoresistant osteosarcoma cells promote drug resistance through miR-331-3p and autophagy. Hence, inhibition of miR-331-3p could alleviate drug resistance in osteosarcoma.
In this study, the transmission role of miRNA-exo was investigated in drug resistance in osteosarcoma. It has been reported that osteosarcoma chemoresistant cells can transmit multiple drug-resistant gene phenotypes into non-drug-resistant cells via exo, causing non-drug-resistant OSCs to develop drug resistance [
17]. Besides, exo could carry DNAs, RNAs, lipids, and proteins for cellular communication in tumor development, and it has been widely investigated in bone sarcomas [
25,
26]. Exosomes participate in numerous physiological and pathological processes via intercellular substance exchange and signaling [
27]. The results of the present study are consistent with the previous study. Indeed, the non-resistant OSCs could internalize the exo isolated from CDDP-resistant OSCs, but non-resistant OSCs exposed to exo from CDDP-resistant OSCs developed CDDP resistance. Furthermore, chemoresistance could be prevented by inhibiting the production of exo or suppressing miRNAs. Non-code RNA has been widely explored. It has been reported that CircDOCK1 promotes the tumorigenesis and cisplatin resistance of osteogenic sarcoma via the miR-339-3p/IGF1R axis [
28]. Furthermore, previous studies focused on the cell-derived exo that regulate the proliferation, invasion, and chemoresistance of OSCs. BMSCs-derived exo miR-208a promotes the proliferation and metastasis of OSCs [
29]. Another study found that the exo secreted by metastatic OSCs could deliver miR-675 to regulate the bioactivity of osteosarcoma by targeting Calnexin-1 [
17]. Wang et al. [
30] reported that the exo secreted by tumor-related fibroblasts could transmit miR-1228 into OSCs to promote the proliferation and invasion of OSCs by targeting SCAI (which encodes a suppressor of cancer cell invasion). Thus, miRNA-containing exo are an effective transmission route for various factors affecting the biological behavior of OSCs, including drug resistance.
In the present study, the involvement of miR-331-3p was identified as being involved in the transmission of drug resistance in OSCs. It has been reported that miR-331-3p could inhibit the proliferation and migration of colon cancer cells by targeting NRP2 (Neuropilin 2) [
30]. Another study showed that circ-0001649 sponges and inhibits the function of miR-331-3p, suppressing non-small cell lung cancer [
31]. A high serum miR-331-3p expression was considered a high-risk factor for esophageal cancer recurrence [
32]. A study on miR-331 and chemotherapy in leukemia reported that an increased expression of miR-331 might lead to poor treatment efficacy and low survival rates [
33]. Therefore, these previous studies support that miR-331-3p can cause tumor recurrence and poor prognosis. Still, the previous studies also highlight that the expression profile and regulatory roles of miR-331-3p are different across different tumor types. Bi et al. [
34] reported that miR-331-3p could suppress osteosarcoma progression by targeting MGAT1, involving the Bcl-2/Bax and Ent/β-Catenin pathways. Zu et al. [
35] reported that miR-331-3p overexpression inhibited osteosarcoma cell proliferation, metastasis, and invasion by targeting the SOCS1/JAK2/STAT3 pathway. Still, no relevant reports have been published regarding chemoresistance in osteosarcoma and miR-331-3p. In the present study, the expression of miR-331-3p in chemoresistant OSCs was higher than in non-resistant OSCs, suggesting that miR-331-3p participates in the chemoresistance or aggressiveness of osteosarcoma. Most importantly, the present study showed that miR-331-3p can be transmitted among cells via exo, and that the exo-carried miR-331-3p can induce chemoresistance in previously non-resistant cells. Still, the exact mechanisms of this chemoresistance due to miR-331-3p remains elusive in osteosarcoma, and, as highlighted above, the mechanisms might differ among cancer types. Nevertheless, so far, miR-331-3p is upregulated in pancreatic cancer cells, where it induces resistance to gemcitabine by activating the Wnt/β-catenin signaling through ST7L [
36]. miR-331-3p has been shown to participate in the epithelial-to-mesenchymal transition [
37‐
39], and cells that underwent that transition can be more resistant to chemotherapy [
40]. Since the Wnt/β-catenin signaling pathway is also involved in chemoresistance in osteosarcoma, the involvement of miR-331-3p and Wnt/β-catenin signaling in the chemoresistance of OSCs should be investigated in future studies. Therefore, the miR-331-3p-related chemoresistance observed here, and the miR-331-3p-inhibited osteosarcoma aggressiveness in previous studies [
34,
35] could be context-dependent. Still, studies are needed since the same pathways appear to be involved in both processes.
In this study, exo from chemoresistant OSCs could induce autophagy of OSCs. Programmed cell death including ferroptosis, necroptosis and pyroptosis, governed by a diverse array of genes, serves as a pivotal mechanism in the progression and maturation of organisms. Additionally, it is essential for the preservation of tissue and organ equilibrium and contributes to numerous pathological phenomena [
41]. Autophagy is an important pathway involved in the drug resistance of cancer cells [
18]. In the present study, miR-331-3p could cause autophagy of OSCs, while the inhibition of miR-331-3p suppressed the autophagy of OSCs. Inhibition of miR-331-3p and miR-9-5p ameliorated Alzheimer’s disease by enhancing autophagy [
42]. Thus, it could be hypothesized that exo miR-331-3p induced autophagy and increased the cell vitality and chemoresistance of OSCs. Still, autophagy is a complex process that several factors can influence in vivo, and additional studies are still necessary to examine the effects and regulation of autophagy in OSCs. Still, it is increasingly being recognized that autophagy is involved in the chemoresistance of osteosarcoma [
43], and thus modulating autophagy could help improve the prognosis of the patients through a better response to treatments. Of course, this study has limitations. It focused on a single miR-331-3p, while it is known that exo carry multiple miRNAs that can act synergistically or additively on the target cells. The exact molecular mechanisms involved in miR-331-3p-related chemoresistance were not investigated. Only cells were investigated, and future studies should include xenografts in nude mice.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.