Nucleus pulposus (NP) cell apoptosis contributed to disc degeneration. Baicalein, a natural steroid saponin, has been demonstrated to have anti-inflammatory, antiapoptotic, and antioxidative effects in various diseases. However, little is known about the roles of baicalein in intervertebral disc degeneration.
Methods
To evaluate the roles of baicalein in disc degeneration and its specific mechanism, human NP cells were incubated with TNF-α and various concentrations of baicalein. Cell viability, extracellular matrix protein expression, catabolic factors, degree of apoptosis, inflammatory factors, and related signaling pathways were evaluated by western blotting, fluorescence immunostaining, TUNEL staining, and reverse transcription PCR.
Results
Baicalein inhibited TNF-α-activated apoptotic signaling and catabolic activity in NP cells. Baicalein promoted PI3K/Akt signaling and attenuated the level of apoptosis-related markers in TNF-α-stimulated human NP cells.
Conclusion
Our work provides that baicalein attenuates TNF-α-activated apoptosis in human NP cells through promoting the PI3K/Akt pathway, indicating that baicalein is a new potential candidate for clinical therapy to attenuate disc degeneration.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Background
The intervertebral disc is an important component of the spinal column, and its dysfunction was the main reason to lead to lower back pain [1]. Low back pain imposed a serious burden on patients’ lives as well as cause very heavy economic and social burden [2]. According to the statistics, at least 70% of people will suffer from low back pain at some point in their life in western countries [3, 4]. Intervertebral disc degeneration is a leading cause of low back pain.
Research on disc degeneration has mainly focused on the changes in metabolites during the stress process of the intervertebral disc itself. It is believed that the abnormal stress and nutritional dysfunction will eventually triggering nucleus pulposus cells apoptosis [5, 6].
Anzeige
NP cells are present in a gelatinous extracellular matrix (ECM) containing collagen II and proteoglycan, which are essential for resistance to compressive axial force of the spine [7, 8]. In healthy NP tissue, the NP cell maintains the metabolic balance of ECM, including aggrecan and collagen with long half-lives [9]. Studies have demonstrated that matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase with thrombospondin type I motifs (ADAMTSs) disrupt the balance of ECM metabolism during the pathological process of disc degeneration.
Various pro-inflammatory mediators, containing tumor necrosis factor (TNF)-α and interleukin-1β (IL-1β), have been shown to be significantly upregulated in degenerative disc tissue in humans [10, 11]. TNF-α and IL-1β, two essential proinflammatory factors, have been shown to be closely related to the progression of IDD [12]. TNF-α can trigger inflammation, leading to neural swelling and neuropathic pain, and aggravate cell apoptosis due to its cytotoxic effects in humans with lower lumbar pain. IL-1β, the best studied proinflammatory factor, has been shown to trigger the level of various proinflammatory mediators, including TNF-α, IL-6, and several matrix-degrading enzymes, disrupting the balance of ECM metabolism and impairing its turnover in the intervertebral discs [13]. Several molecular pathways, such as nuclear factor-kappa B (NF-κB), mitogen-activated protein kinase (MAPK) and PI3K/Akt signaling pathway, have been shown to be major moderators of IL-1β-induced inflammation and catabolism [14]. The phosphatidylinositol-3-kinase (PI3K)/Akt (PI3K/AKT) pathway is the most commonly altered signaling pathway in human disease. The PI3K/AKT signaling pathway affects many cellular processes including cell proliferation, apoptosis and invasion in a wide variety of cells. Therefore, inhibiting apoptosis of NP may be key for mitigating disc degeneration.
Baicalein, a typical flavonoid compound, is extracted from Radix Scutellariae [15]. Pharmacological works have suggested that baicalein has anti-inflammatory, antiapoptotic, and antioxidative effects in various diseases. For instance, Baicalein was shown to attenuate dimethylnitrosamine-induced acute liver injury by inhibiting apoptosis via reductions in the expression of proapoptotic proteins. Baicalein was also reported to attenuate cerebral ischemia/reperfusion injury via inhibiting toll-like receptor 4 (TLR4) signaling [16].
However, little is known about the potential effects of baicalein on NP cells apoptosis.
Anzeige
Therefore, this study aimed to explore the potential effects of baicalein in TNF-α-treated NP cells and its specific mechanism of action. We hypothesized that baicalein attenuates TNF-α-activated apoptosis in human NP cells through promoting the PI3K/Akt pathway.
Materials and methods
Chemicals and materials
Baicalein (Fig. 1) with a purity > 99% was purchased from Sigma Chemical Co. (Sigma-Aldrich, Darmstadt, Germany). Baicalein was dissolved in dimethyl sulfoxide (DMSO), with final DMSO concentrations of less than 1%. TNF-α was acquired from R&D Systems (St. Paul, MN, USA). All of the antibodies were acquired from Santa Cruz (Santa Cruz, CA, USA) and Cell Signaling Technology (Beverly, MA, USA). Other reagents not mentioned here were acquired from Solarbio Co. (Beijing, China). This study complies with the World Medical Association Declaration of Helsinki.
×
Primary human NP cell culture and treatment
This study was approved by the Ethics Committee of the Tianjin Hospital (CZX2022-KY-011). Informed consent for disc tissue collection was acquired from patients or their relatives. Human nucleus pulposus tissues were derived from 20 patients (6 male patients and 14 female patients; mean age, 45 ± 8.7) with degenerated discs of Pfirrmann level I or II. The protocol of human NP cells culture was performed as described previously [17]. In brief, NP tissues were cut into pieces and enzymatically digested in 0.2% type II collagenase and 0.25% trypsin for 3 h. After filtration through a 70-μm filter mesh to remove cell clumps. NP cells were maintained in DMEM culture medium with 20% fetal bovine serum (FBS). NP cells were stained with toluidine blue, Safranin O and immunohistochemical staining of type II collagen. Identification of NP cells can be seen in Additional file 1. Nucleus pulposus cells were positive for toluidine blue staining (Additional file 1-A), Safranin O (Additional file 1-B) and immunohistochemistry staining of type II collagen (Additional file 1-C).
NP cells at passage 3 were prepared for reverse transcription PCR and western blotting. The cells were planted into 6-well plates. After 2 days, the samples were treated with Baicalein (0, 5, 10, 20, 30, 40, 50 and 60 μM) supplemented with TNF-α (0, 10, 50 and 100 ng/mL) for 1 day, and NP cells were then used for the experiments. The timing of TNF-α intervention for NP cell refers to previously published literature [18].
Viability assay
The NP cells were seeded and cultured in 96-well plates (6 × 103cells/well) for 1 day and incubated with various concentrations of Baicalein with or without TNF-α (50 ng/mL). After incubation for 1 day, CCK-8 solution (10 μL) was added to each well for 2 h. CCK-8 solution was sterilized by filtration through 0.22-μm-pore-size filters (Costar). The absorbance of sample was tested at 450 nm by a spectrophotometer.
TUNEL assay
NP cells were seeded and cultured on coverslips, treated with 4% paraformaldehyde for 15 min, and then treated in 0.5% Triton X-100 for 10 min. Following incubation in blocking buffer containing 5% BSA for 30 min, we incubated, fixed, and permeabilized the cells for 1 h with the TUNEL reaction mixture in a humidified atmosphere in the dark. The sample was sealed with VECTASHIELD (Vector Laboratories, Burlingame, CA, USA) including DAPI. The immunostained sample was imaged by laser scanning confocal microscopy. Quantitation of TUNEL labeling is expressed as the number of TUNEL-positive nuclei per area of section, and numbers are an average of at least three independent sections of cells.
RNA sequencing
There were four biological replicates for TNF-α and TNF-α + Baicalein. RNA was isolated, and concentration was measured according to previously described. RNA sequencing was then performed by Novogene Bioinformatics Technology Co., Ltd (Beijing, China). Differential expression analysis was done using R “limma” package. Meanwhile, volcano plot and heatmap were generated using R software. The function cluster analysis of differentially expressed genes was carried out using Metascape website (http://metascape.org/gp/index.html#/main/step1).
Predicting targets of baicalein
In STITCH database (http://stitch.embl.de/), the drug’s name (Baicalein) was used for target searching. We set the minimum required interaction score was 0.4000 and P value less 0.05 was identified statistically significant. The target proteins were mapped to the Database for Annotation, Visualization and Integrated Discovery (DAVID, https://david.ncifcrf.gov) to enrich gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. The filtered P value matrix was then transformed by the function x = − log10 (P value).
Anzeige
Western blotting
All protein samples were isolated using cell lysis buffer. The concentration of total protein was tested by the BCA kit. The protein specimens were added onto SDS gel electrophoresis and transferred onto PVDF membrane. After blocking nonspecific binding sites, the membrane was immunoblotted with primary antibodies. On the following day, the sample was treated with the secondary antibody for 60 min at 37 °C. Band was detected using the ChemiDoc XRS + Imaging System.
Reverse transcription PCR assay
Total RNA of NP cells was extracted using TRIzol method. Reverse transcription was conducted reverse transcriptase amplification kit (Fermentas, New York, USA). Specific reverse transcription primers and quantitative PCR primers were obtained from RiboBio Co. Ltd. (Guangzhou, China). qRT-PCR was performed by the SYBR Premix DimerEraser on a 7900HT system. GAPDH were regarded as the internal references for mRNA. The qRT-PCR results were analyzed by the 2−ΔΔCt method. Primer sequence is shown in Table 1.
Table 1
Primer sequence of the target genes
Target gene
Forward (5′–3′)
Reverse (5′–3′)
Product lengths (bp)
Bax
CCCGAGAGGTCTTTTTCCGAG
CCAGCCCATGATGGTTCTGAT
155
Bcl-2
GGTGGGGTCATGTGTGTGG
CGGTTCAGGTACTCAGTCATCC
89
Cleaved cas-3
AAATTGTGGAATTGATGCGTGA
TACAACGATCCCCTCTGAAAAA
164
Cleaved cas-9
GGTCACGGCTTTGATGGAGAT
CCACCTCAAAGCCATGGTCTT
132
MMP-2
TGGCGATGGATACCCCTTT
TTCTCCCAAGGTCCATAGCTCAT
85
MMP-9
TGCCCGGACCAAGGATACAG
TCAGGGCGAGGACCATAGAG
92
GAPDH
AGAAGGCTGGGGCTCATTTG
AGGGGCCATCCACAGTCTTC
258
Statistical analysis
Results were performed as the means ± standard deviation (SD). Differences among groups were tested by one-way analysis of variance and Tukey’s post hoc test. P < 0.05 was regarded as statistical significance.
Results
Effects of baicalein on TNF-α-activated cell viability in human NP cells
We first examined the safe dose range of Baicalein that did not adversely affect the NP cells viability using the CCK-8 method. Baicalein exhibited no effects on cell viability at doses of 5–30 μM (Fig. 2A). A high concentration (> 30 μM) of Baicalein increased the cell viability while a destructive outcome was observed under a concentration of 60 μM. We therefore chose 50 μM Baicalein for further experiments.
×
Anzeige
NP cells were then incubated with different concentration of TNF-α. However, cell viability decreased with increasing TNF-α concentration (Fig. 2B). The difference of cell viability between the TNF-α of 50 ng/mL and 100 ng/mL was not significant (P = 0.307). We chose 50 ng/mL as the TNF-α concentration for further study. Pretreatment with Baicalein partially reversed the inhibitory effect of TNF-α on NP cells viability (Fig. 2C).
Effects of baicalein on TNF-α-activated apoptotic signaling in human NP cells
To explore the effect of Baicalein on NP cells apoptosis, we performed a TUNEL assay and found that the percentage of the TUNEL-positive NP cells in the TNF-α is higher than that in the control group. Pre-treatment with Baicalein reduced the TUNEL-positive cell counts (Fig. 3A, P < 0.05).
×
To confirm the above results, Annexin V-FITC/PI assay was then conducted. The rate of apoptosis increased from 3.0 ± 1.0% in the control group to 12.0 ± 1.1% in the TNF-α stimulation group (Fig. 3B, P < 0.05). However, after pretreatment with Baicalein, the apoptotic rate decreased to 5.1 ± 0.8%. To further understand the molecular mechanisms underlying the Baicalein mediated apoptosis in NP cells, we investigated apoptosis-related mRNA (Fig. 3C) and protein (Fig. 3D) expression in NP cells. Results indicated that TNF-α significantly increased the expression of the proapoptotic protein Bax, Cleaved caspase-3 and Cleaved caspase-9 and decreased the expression of the anti-apoptotic protein Bcl-2 compared with control group. In Baicalein pre-treatment group, trends in these measures were remarkably reversed. These results suggest that Baicalein may reverse the TNF-α-induced apoptosis through intrinsic apoptotic pathway in NP cells.
RNA sequencing results
Median values in the two groups were almost identical after normalized (Fig. 4A). A total of 697 differentially expressed genes were identified (upregulated = 471, downregulated = 226). The volcano plot and heatmap of differentially expressed genes are presented in Fig. 4B, C, respectively. Furthermore, gene ontology indicated these differentially expressed genes mainly enriched in response to lipopolysaccharide, extracellular matrix organization, cell–cell signaling, response to hypoxia, signal transduction, extracellular space, extracellular region, proteinaceous extracellular matrix, plasma membrane, integral component of plasma membrane, cytokine activity, heparin binding, chemorepellent, chemorepellent activity, receptor binding and growth factor activity (Fig. 4D).
×
Anzeige
Pathway analysis revealed that differentially expressed genes mainly enriched in PI3K/Akt signaling pathway, Pathways in cancer, Neuroactive ligand-receptor interaction, TGF-beta signaling pathway and Rap1 signaling pathway (Fig. 4E).
Baicalein suppressed TNF-α-activated apoptotic activity in human NP cells
Network analysis using the STITCH database revealed tight network among the Baicalein significantly altered proteins (Fig. 5A). Includes the following proteins: CYP1A2, CYP3A4, ALOX15, ALOX12, MMP-2, CDK4, MMP-9, AKT1, PLAU and MAPK1. In total, these altered proteins mainly involved in 10 BP (Fig. 5B), 6 CC (Fig. 5C) and 10 MF (Fig. 5D) terms. The most significant terms of BP, CC and MF enriched by altered proteins were, respectively, regulation of phosphorylation, cyclin-dependent protein kinase holoenzyme, and cyclin-dependent protein. KEGG pathway enrichment analyses were also performed and are presented in Fig. 5E. We found that the PI3K/Akt signaling pathway was the most significantly enriched pathway based on KEGG analysis. Next, we determined if Baicalein play an anti-apoptosis role in NP cells through regulates the PI3K/Akt pathway. We then measured the gelatinases expression (including MMP-2 and MMP-9) in NP cells. PCR results shown that TNF-α administration could significantly increase the mRNA expression of MMP-2 and MMP-9, Baicalein pretreatment significantly reduced the MMP-2 and MMP-9 expression (Additional file 2-A). Western blot results were in accordance with the results of RT-PCR (Additional file 2-B).
×
Baicalein attenuates apoptosis in TNF-α-stimulated human NP cells through PI3K/Akt signaling pathway
To test whether Baicalein attenuates apoptosis in TNF-α-stimulated human NP cells through PI3K/Akt signaling pathway. We first compared the levels of PI3K and Akt and phosphorylated PI3K (p-PI3K) and Akt (p-Akt) in TNF-α stimulated alone or with Baicalein (Fig. 6A). PI3K and Akt phosphorylation was increased after TNF-α treatment and Baicalein pretreatment significantly reduced this phosphorylation. Finally, we examined the expression levels of PTEN, which is the upstream regulatory of PI3K/Akt signaling pathway. We revealed that baicalein pretreatment could reverse the inhibitory effects of TNF-α on the PTEN expression.
×
Next, we performed an experiment using LY294002, an inhibitor of the PI3K/AKT pathway. These anti-apoptotic effects of baicalein were partially reversed by pretreatment with LY294002 (Fig. 6B).
We found that inhibition of PI3K and Akt phosphorylation with a PI3K specific inhibitor (LY294002) substantially abrogated PI3K and Akt phosphorylation induced by Baicalein (Fig. 6C).
Western blotting indicated that pretreatment with LY294002 in baicalein group significantly increased the expression of the proapoptotic protein Bax, Cleaved caspase-3 and Cleaved caspase-9 while decreased the expression of the anti-apoptotic protein Bcl-2. These data suggest that Baicalein prevents TNF-α-induced apoptosis through PI3K/Akt signaling pathway.
Discussion
Studies have suggested that inflammation and apoptosis are two essential characteristics in NP tissue during the pathological process of IDD [19]. In healthy NP tissue, the NP cells maintain the metabolic balance of ECM, including aggrecan and collagen, with long half-lives [9]. A recent study showed that apoptosis of NP cells is closely related to ECM degradation [20]. Furthermore, inflammatory cytokines (IL-1β and TNF-α) attract death-related signaling complexes through interaction with their specific ligands, and then initiate apoptotic signaling, contributing to DNA fragmentation [21].
It was reported that Baicalein protected PC12 cells against Aβ25-35-induced cytotoxicity via inhibition of apoptosis [22]. Baicalein was also shown to alleviate liver oxidative stress and apoptosis induced by high-level glucose through activation of the PERK/Nrf2 signaling pathway [23].
The results of the present work suggested that TNF-α promotes NP cell apoptosis, which is partly inhibited by baicalein. These results suggest that Baicalein exerts an antiapoptotic effect on NP cells in an inflammatory environment. Another strength of this study was that we used STITCH database to predict candidate target proteins of Baicalein.
To better understand the potential biological functions of these candidate proteins, we performed the gene ontology (GO) and KEGG analysis. These proteins mainly participant into regulation of protein phosphorylation and PI3K/Akt signaling pathway was the most enriched pathway.
The PI3K/AKT pathway is involved in protecting cells from apoptosis has been reported in many previous studies [24‐26]. First, we found that baicalein enhanced PI3K and Akt phosphorylation level in TNF-α stimulated NP cells. Wang et al. [27] also revealed that baicalein could also stimulate PI3K and Akt phosphorylation in undifferentiated thyroid cancer cells. Similar to our research, baicalein improves glucose metabolism in insulin resistant HepG2 cells through PI3K/Akt signaling pathway.
Conclusion
PI3K/Akt signaling was suggested to be related to the mechanisms of action of baicalein against TNF-α-activated apoptosis in human NP cells. All results provide the pharmacological effects and mechanisms of action of baicalein, which should be considered as a potential new candidate for clinical therapy to attenuate disc degeneration. A further in vivo study will be required to verify the above in vitro experimental results.
Acknowledgements
Not applicable.
Declarations
Ethics approval and consent to participate
The research protocol was approved by the Ethics Committee of Tianjin Hospital.
Consent for publication
The manuscript is approved by all authors for publication. All the authors listed have approved the manuscript that is enclosed.
Competing interests
The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Zur Zementierung einer Knie-TEP wird in Deutschland zu über 98% Knochenzement verwendet, der mit einem Antibiotikum beladen ist. Ob er wirklich besser ist als Zement ohne Antibiotikum, kann laut Registerdaten bezweifelt werden.
In der Notaufnahme wird die Chance, Opfer von häuslicher Gewalt zu identifizieren, von Orthopäden und Orthopädinnen offenbar zu wenig genutzt. Darauf deuten die Ergebnisse einer Fragebogenstudie an der Sahlgrenska-Universität in Schweden hin.
Darüber reden und aus Fehlern lernen, sollte das Motto in der Medizin lauten. Und zwar nicht nur im Sinne der Patientensicherheit. Eine negative Fehlerkultur kann auch die Behandelnden ernsthaft krank machen, warnt Prof. Dr. Reinhard Strametz. Ein Plädoyer und ein Leitfaden für den offenen Umgang mit kritischen Ereignissen in Medizin und Pflege.
Ein Frauenanteil von mindestens einem Drittel im ärztlichen Op.-Team war in einer großen retrospektiven Studie aus Kanada mit einer signifikanten Reduktion der postoperativen Morbidität assoziiert.
Update Orthopädie und Unfallchirurgie
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.