Introduction
Rheumatoid arthritis (RA) is an autoimmune disease with an unknown etiology. Its primary characteristics include chronic inflammation and hyperplasia of the synovial membrane within joints, which in turn affects the articular cartilage, resulting in cartilage damage, and destruction, and ultimately leading to joint deformities and functional loss [
1,
2]. Rheumatoid arthritis extends beyond the joints; the lungs, with their abundant connective tissue and blood supply, are commonly affected organs. In recent years, there has been a growing focus on the investigation of interstitial lung disease [
3,
4]. Rheumatoid arthritis interstitial lung disease is frequently undetected during its early stages due to the lack of apparent clinical symptoms. Furthermore, the prognosis for pulmonary fibrosis in advanced stages is exceedingly grim [
5]. The primary pathological manifestations of RA-ILD include localized fibroblast proliferation, accumulation of extracellular matrix, and the development of alveolar cystic-cavity-like dilatation in lung tissue. These changes result in the distortion of the typical lung structure and a decrease in the effective air exchange area in the distal region. Consequently, the majority of patients eventually succumb to hypoxic respiratory failure [
6].
Resveratrol is a naturally occurring polyphenol, abundant in grapes, known for its potent antioxidant, anti-inflammatory, and antibacterial properties [
7]. In a particular study, it was discovered that resveratrol decreased synovial proliferation, lowered inflammatory markers, and mitigated oxidative damage in an experimentally induced arthritis model [
8,
9]. Resveratrol can suppress inflammatory responses, and cellular proliferation, and induce synovial cell apoptosis by inhibiting the MAPK signaling pathway and diminishing ROS accumulation [
10]. Additionally, resveratrol enhances rheumatoid arthritis by triggering the SIRT1-Nrf2 signaling pathway [
11]. While the mechanism of resveratrol in mitigating rheumatoid arthritis has been extensively documented, its potential to attenuate the progression of RA-ILD has received relatively less attention. In this study, we investigated the potential of resveratrol as a therapeutic agent for RA-ILD.
Autophagy is a cellular process that involves the degradation of dysfunctional cellular components through the action of lysosomes within the cell [
12]. Autophagy is a cellular process that involves the degradation of dysfunctional cellular components through the action of lysosomes within the cell [
13,
14]. Recently, the role of autophagy in autoimmune diseases has garnered significant attention and recognition [
15]. Notably, research in the context of rheumatoid arthritis has revealed, for instance, that autophagy triggers protein aminoacylation in fibroblast-like synovial cells derived from individuals with rheumatoid arthritis [
16]. Autophagy mitigates joint damage caused by synovial cells through the involvement of optineurin [
17]. Furthermore, autophagy plays a significant role in the development of pulmonary fibrosis [
18‐
20]. Research has demonstrated that resveratrol can suppress fibrosis in RA-ILD by reinstating autophagy [
21].
TMEM175 is a K
+ channel protein primarily found within nuclear endosomes and lysosomes. Its main function is facilitating K
+ transmembrane transport [
22]. Nevertheless, it has been discovered that TMEM175 possesses not only a K
+ transporter function but also a notably robust H
+ transporter function [
23,
24]. Protein kinase B (Akt), alternatively referred to as PKB or Rac, holds a pivotal role in regulating cell survival and apoptosis [
25]. Growth and survival factors, including insulin, can activate the Akt signaling pathway [
26]. Research revealed that AKT associates with TMEM175 to create a lysosomal K-channel complex. This complex is activated by growth factors and plays a role in regulating lysosomal K
+ and H
+ transport through AKT gating, consequently controlling lysosomal pH [
27‐
29].
The objective of this study was to explore the function and underlying mechanism of resveratrol in alleviating rheumatoid arthritis in the presence of interstitial lung disease. Specifically, this mechanism involves the restoration of autophagic lysosomal flux through the AKT/TMEM175 pathway.
Materials and methods
Animal model
Eight-week-old male C57BL/6 mice with a body weight ranging from 20 to 25 g were randomly assigned to one of three groups: (I) Ctrl (Control), (II) CIA (collagen-induced arthritis models), and (III) CIA + Res (CIA models treated with resveratrol at 10 mg/kg). Male C57BL/6 mice were procured from Jiangsu Ji Cui Biotechnology Co., Ltd. (Nanjing, China) and acclimated to laboratory conditions at Anhui Medical University for a minimum of 1 week before the experiment. The induction of CIA in mice involved the use of complete Freund’s adjuvant (CFA) and chicken type II collagen (CCII). CCII (Chondrex, Woodinville, WA, USA) at a concentration of 2 g/L was dissolved in 0.05 mol/L glacial acetic acid, thoroughly stirred, and stored at 4 °C overnight. Subsequently, CFA (Chondrex, Woodinville, WA, USA) was mixed with an equivalent volume of the dissolved Col II and completely emulsified in an ice bath using a homogenizer. For the CIA + Res group, animals received resveratrol (Aladdin, Shanghai, China) via oral gavage, dissolved in 0.5% sodium carboxymethylcellulose (carrier) at a final concentration of 1 mg/mL, with a daily dosage of 0.1 mL per 10 g of body weight, administered for 10 days. The control group received an equivalent volume of normal saline via tracheal and tail root injection, serving as the negative control. The resveratrol dosage was determined based on prior research findings [
30]. All animals were euthanized 24 h after the final resveratrol treatment. Lung tissue was excised, with a section reserved for pathological analysis. The remaining lung tissue was promptly frozen in liquid nitrogen to facilitate subsequent bioanalysis.
Hematoxylin–Eosin (H&E) staining
Following fixation with 4% neutral paraformaldehyde, knee tissue specimens underwent a 2-week immersion in EDTA decalcification solution (Boster, Wuhan, China) under room temperature agitation. Subsequently, they were subjected to standard dehydration and paraffin embedding procedures. Paraffin sections were approximately 3.5 µm thick, and these sections were deparaffinized and subjected to a series of alcohol and distilled water washes. Hematoxylin staining was performed for 15 s, followed by a 20-min tap water rinse to counterstain. Subsequently, 5% eosin staining for 3 min was carried out, and the sections were rapidly dehydrated. Finally, a neutral resin was used to seal the slides. Lung tissue specimens followed a similar process, including fixation, dehydration, paraffin embedding, and sectioning at a thickness of approximately 3.5 µm. HE staining was performed on these lung tissue sections as well.
Masson staining
Masson staining (Solarbio, Beijing, China) was employed to identify fibrosis. The cells were subjected to iron hematoxylin staining for 8 min at room temperature for nuclear staining, followed by differentiation to achieve a blue color. Subsequently, they were stained with aniline blue for 1.5 min, washed with weak acid, dehydrated, and sealed. Finally, observations were made under a microscope (Nikon Eclipse 80I), and analysis was conducted using Image Pro 6 (Media Contronetics Inc., Bethesda, MD, USA).
Immunohistochemistry
Following the standard dewaxing of paraffin sections, endogenous peroxidase activity was quenched by incubation with 3% H2O2 for 20 min. Subsequently, antigen retrieval was performed using a microwave for 10 min, and the primary antibody was incubated at 4 °C overnight. The addition of the secondary antibody was followed by a 60-min incubation at room temperature. DAB (Solarbio, Beijing, China) was utilized for color development, and the slides were counterstained with hematoxylin before sealing with neutral resin. Five randomly selected areas within each section were examined under a light microscope. Positive expression was indicated by yellow–brown staining in the cytoplasm or cytoplasmic membrane. The proportion of positive area (positive area/total area) was quantified using ImageJ software.
Hydroxyproline assay
Following the kit instructions (Solarbio, Beijing, China), approximately 0.2 g of the sample was weighed into a glass tube. The tissue was minced as finely as possible for digestion, and 2 mL of extraction solution was added before bringing it to a boil. After cooling, the pH was adjusted to the range of 6–8 using 10 mol/L NaOH (approximately 1 mL), and then distilled water was added to reach a final volume of 4 mL. Subsequently, centrifugation was carried out at 16,000 rpm and 25 °C for 20 min. The spectrophotometer wavelength was set to 560 nm, and the supernatant was collected for measurement.
Malondialdehyde assay
Approximately 0.1 g of tissue was weighed and homogenized in 1 mL of extraction solution on ice. After centrifugation at 8000×g for 10 min at 4 °C, the supernatant was collected and kept on ice for subsequent measurements. Following the kit instructions (Solarbio, Beijing, China), 200 μL of the supernatant was pipetted into either a micro glass cuvette or a 96-well plate, and the absorbance of each sample was measured at 532 nm and 600 nm.
Molecular docking
Three-dimensional structural representations of the crucial active components of resveratrol were acquired from the PubChem database to serve as ligand files for subsequent molecular docking. The 3D structures of the target proteins were retrieved as receptor files from the RCSB database (
https://www.pdbus.org/). AutoDock (version 1.5.6) was employed to extract small ligand molecules from the receptors, perform side chain corrections, and introduce hydrogen atoms. Subsequently, AutoDock Vina (version 1.1.2) was utilized for molecular docking. A protein binding affinity below − 5 kcal/mol indicates significant binding activity with the compound. The docking outcomes for the compounds and proteins displaying the most favorable conformations were subjected to analysis and visualization using PyMol software.
Molecular dynamics simulations of target protein complexes
Gromacs was utilized to conduct molecular dynamics simulations on the resveratrol-TGF-β1 protein complex, which exhibited the highest binding free energy in molecular docking. Protein modeling employed aber14SB force field parameters, while small molecule ligands were modeled with Gaff generic force field parameters. The OPC water model was employed to introduce solvents into the protein–ligand system. Subsequently, a water tank was established and supplemented with Na+ and Cl− to achieve system equilibrium. Energy optimization was carried out employing the most rapid descent and conjugate gradient methods. Conformational constraints were applied, followed by Nvt pre-equilibrium and Npt pre-equilibrium, culminating in MD simulations. Binding free energy serves as the primary criterion for assessing drug molecule activity, with lower values indicating greater complex stability.
Cell lines and cell culture
The human embryonic lung fibroblast cell line (MRC-5) was procured from the American Typical Collection of Biological Resources (ATCC, Rockville, MD, USA) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies/Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco) and 1% antibiotics (containing 100 U/mL penicillin, 100 μg/mL streptomycin, Sigma-Aldrich, St. Louis, MO, USA). The cells were maintained in a 37 °C incubator with 5% CO2. To induce a cellular model of RA-ILD, recombinant TGF-β1 and IL-1β were added to the cell culture medium for a 24-h incubation period. TGF-β1, IL-1β, SC79, MK2206, chloroquine (CQ), and bafilomycin A1 (BAFA1) were procured from MedChemExpress, while MG132 was obtained from Selleckchem.
Cell transfection and processing
SiRNA targeting TMEM175 (Si-TMEM175) was custom-designed and synthesized by General Biologicals. Cells were transfected with SiRNA at a concentration of 50 nmol/L using Lipo2000 (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s guidelines. Subsequently, the transfected cells were utilized for experiments. The sequence of Si-TMEM175 is provided in Table
1.
Table 1
Small interfering RNA and primer sequences
Si-NC | Sense UUCUCCGAACGUGUCACGUTT |
Antisense ACGUGACACGUUCGGAGAATT |
Si-TMEM175 | Sense GCAGGUUCAGUGUGGGCAUTT |
Antisense AUGCCCACACUGAACCUGCTT |
PKC-A | Forward CTGTTCCCACCCTATCACTCC |
Reverse GCTCGGAAGCCTCATAAGAT |
PKC-B | Forward ACCAAAAGCTAGAGACAAGCGA |
Reverse GTGGGAGTCAGTTCCACAGG |
PKC-D | Forward GCCTTCCATGGCTTCTCCTT |
Reverse CCAGTCACCCACTGTTCTCC |
GSK3B | Forward CAGGACATTTCACCCCAGGA |
Reverse AGGTGTGTCTCGCCCATTTG |
TFEB | Forward CGCAGAGAACGGAGACGG |
Reverse TGAAGGTCAATCTGTCCGCC |
RAB7A | Forward CGTGACAGACACTTCCGCT |
Reverse AACGGAGGAGGAGACACAAC |
TBC1D15 | Forward GAAAGCTGTTGTGGGCCATT |
Reverse CTGCCTCGCAAACTGTCAAA |
FIS1 | Forward CAGTTGCGTGTGTTAAGGGATGAA |
Reverse TTCAAAATTCCTTGCAGCTTCGT |
VAMP8 | Forward TGCCTTGGGTGGAAACAGAC |
Reverse TGCAGGTTCCTAACTCGGTC |
SNAP29 | Forward TAGATGAGCTGTCCGTGGGA |
Reverse TGGTTGTCAGTCGGTCAAGG |
STX17 | Forward CTAGGCGGGAGGTGTTTCTG |
Reverse AGCCTGCGTAACTTCACCTT |
VATPASE | Forward CTGGTTCGAGGATGCAAAGC |
Reverse TCCAAGGTCTCACACTGCAC |
ATP6AP1 | Forward CAGGACAAGAATGCCCTGGAC |
Reverse CTGTGTAGGGCAGACGGATG |
ATP6AP2 | Forward GGACCATTCACCCGACTTGT |
Reverse CACTGCGTTCCCACCATAGA |
TMEM175 | Forward CGATCCTACGGACCTCAAGC |
Reverse GACCAACAAGTTGTCACGGC |
TNF-α | Forward ACCCTCACACTCACAAACCA |
Reverse ACAAGGTACAACCCATCGGC |
IL-1β | Forward TGCCACCTTTTGACAGTGATG |
Reverse AAGGTCCACGGGAAAGACAC |
β-Actin | Forward CAGCCTTCCTTCTTGGGTATGG |
Reverse CGCAGCTCAGTAACAGTCCG |
Cell counting kit-8 (CCK-8) assay
MRC-5 cells were seeded in 96-well plates at a density of 3 × 103 cells per well. After 6–12 h, the cells were stimulated with IL-1β and TGF-β1 for 24 h. Subsequently, following a 24-h treatment with resveratrol, the cells were further incubated for 1–4 h with the addition of 10 μL of CCK-8 solution (Biosharp, Beijing, China) to each well. The absorbance of the cells at 450 nm was assessed using an enzyme-linked marker to evaluate the impact of resveratrol on cell viability.
EDU cell proliferation assay
Culture an appropriate cell number in a 6-well plate. Once the cell culture has returned to its normal state overnight, proceed with the desired treatments. Prepare the EdU working solution (Beyotime Biotechnology, Shanghai, China) and add the preheated EdU working solution at 37 °C to the 6-well plate, incubating the cells for 2 h. Fix the Edu-labeled cells by adding 1 mL of fixative and incubating for 15 min at room temperature. Subsequently, incubate each well with 1 mL of permeabilizing solution for 10–15 min at room temperature. Add 0.5 mL of Click reaction solution to each well and incubate for 30 min at room temperature, away from light. Stain the cell nuclei with Hoechst 33342, followed by fluorescence detection.
Detection of cell ROS
ROS levels were assessed using the DCFH-DA green fluorescent probe (Beyotime Biotechnology, Shanghai, China). DCFH-DA was diluted 1000-fold with DMEM to create a working solution. Subsequently, 1–2 mL of the working solution was added to completely cover the cells growing on the culture dish and incubated at 37 °C for 20 min in the absence of light. Afterward, the cells were washed three times with PBS buffer and imaged using an inverted fluorescence microscope. The alterations in ROS levels in MRC-5 cells were analyzed using ImageJ software.
Mitochondrial membrane potential level detection
The mitochondrial membrane potential was assessed using the mitochondrial membrane potential kit from Beyotime Biotechnology (Shanghai, China). Cells were seeded and incubated overnight at 37 °C. Following the instructions provided with the JC-1 reagent kit, JC-1 was diluted 1000-fold to prepare the working solution. Subsequently, 1–2 mL of the working solution was added to fully cover the cells on the culture dish and incubated at 37 °C in the absence of light for 15 min. The cells were then washed three times with PBS buffer. Images were captured using an inverted fluorescence microscope, and changes in the membrane potential of MRC-5 cells were analyzed using ImageJ software.
mCherry-GFP-LC3 dual fluorescence tracks autophagosome alterations
Cells were transiently transfected with the mCherry-GFP-LC3 construct using EZ Cell Transfection Reagent (Shanghai Life-iLab Biotech, AC04L091). Transfection was performed by adding 3 μg of mCherry-GFP-LC3 plasmid to 9 μL of the transfection reagent, and the culture medium was refreshed every 24 h. After 48 h of cell model treatment, the number of mCherry and GFP fluorescent puncta was directly observed using a laser confocal microscope (Leica SP8, Wetzlar, Germany).
MDC staining
The cells to be examined were subjected to three washes with PBS. Subsequently, 1 mL of MDC staining solution (Beyotime Biotechnology, Shanghai, China) was added to each well, and the cells were incubated in a cell culture incubator at 37 °C for 30 min while protected from light. Afterward, the cells were washed three times with Assay Buffer, with each wash involving 0.8–1 mL of Assay Buffer. Finally, the Assay Buffer was aspirated, and 1 mL of fresh Assay Buffer was added. The green fluorescence was observed using a fluorescence microscope with UV excitation light.
Lyso-tracker red staining
A small quantity of Lyso-Tracker Red (Beyotime Biotechnology, Shanghai, China) was added to the cell culture medium at a ratio of 1:20,000, resulting in a final concentration of 50 nM. The cell culture medium was then aspirated, and the prepared working solution was added, followed by incubation at 37 °C for 30 min. Subsequently, the Lyso-Tracker Red stained working solution was removed, and a fresh cell culture medium was added. Photographic observation was carried out using a laser confocal microscope.
Western blotting
Total protein was extracted from mouse lung tissues and cells using a prepared SDS lysis buffer for protein blotting analysis. The proteins were separated on SDS–polyacrylamide gels and transferred to a polyvinylidene fluoride membrane (PVDF, Merck Millipore, Germany). The membrane was then blocked with 5% skimmed milk for 2 h. Antibodies against β-actin (Abcam, #ab8226), Collagen I (Arigo Biolaboratories, #ARG21965), TGF-β1 (ImmunoWay, #YT4632), P-NFKB (Wanleibio, #WL02169), NFKB (Bioss, #bsm-33117M), TNF-α (Proteintech, #60291-1-Ig), IL-1β (Wanleibio, #WLH3903), HIF-1a (Proteintech, #20960-1-AP), SOD1 (Wanleibio, #WL01846), SOD2 (Boster, #BA4566), LC3-II (Cell Signaling Technology, #12741), P62 (Cell Signaling Technology, #16177S), LAMP2 (Proteintech, #66301-1-Ig), P-mTOR (Abmart, #T56571), mTOR (Abmart, #T55306), P-ULK1 (ImmunoWay, #YP1544), ULK1 (Abmart, #T56902), Beclin1 (Boster, #PB0014), Atg5 (Bioss, #bs-4005r), BNIP3 (Santa Cruz Biotechnology, #sc-56167), P-AKT (Abmart, #T40067), AKT (Abmart, #BM4400), and TMEM175 (Proteintech, #19925-1-AP) were used. The PVDF membrane was incubated with these antibodies at 4 °C overnight. Subsequently, an HRP-labeled secondary antibody (ZSGB-BIO, Beijing, China) was added and incubated for 1 h, followed by detection using the ECL luminescence system.
Co-inmunoprecipitation assay
Transfer 25–50 μL of protein A/G magnetic beads (GenScrip, New Jersey, USA) into 1.5 mL tubes and add 400 μL of Wash Buffer (PBST) to the beads. Dilute Antibody TMEM175 with Wash Buffer to achieve a final concentration of 5–50 μg/mL. Combine 400 μL of the diluted Ab with the Protein A/G beads and incubate at 2 °C for 4 h with rotation. Wash the beads by adding 400 μL of Wash Buffer and gently agitating. Place the tube in a magnetic holder, collect the beads on the side of the tube, discard the supernatant, and repeat this step 4 times. Remove the tube from the magnetic separator, add the sample containing the antigen (Ag), and gently pipette to resuspend the protein A/G bead-Ab complex. Incubate at 2 °C for 4 h to allow Ag to bind to the Protein A/G Bead-Ab complex. Add 400 μL of Wash Buffer to the tube, spin for 5 min, perform a 1-min magnetic separation, and remove the supernatant. Finally, add 25–50 μL of elution buffer to the tube containing the magnetic bead-Ab-Ag complex and spin for 5 min to elute the protein complex.
Immunofluorescence assay
MRC-5 cells were plated in 48-well plates at a density of 1 × 104 cells per well. After 48 h of cell treatment, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature and then rinsed with PBS. Subsequently, the cells were treated with 0.1% Triton-X for 20 min and rinsed again. Afterward, they were blocked with 5% bovine serum albumin (BSA, Solarbio, Beijing, China) for 60 min at room temperature, followed by incubation with antibodies (diluted 1:200) such as LC3-II, P62, etc., overnight at 4 °C. The cells were then rinsed and incubated for 1 h in the dark with secondary antibodies (goat anti-mouse antibody, Proteintech or goat anti-rabbit antibody, Proteintech). Subsequently, DAPI (Beyotime Biotechnology, Shanghai, China) was added to the cells for a 10-min incubation in the dark. Finally, the samples were sealed with an anti-fading mounting medium (Beyotime Biotechnology, Shanghai, China) and observed using an inverted fluorescence microscope.
Total RNA isolation and quantitative real-time reverse transcription PCR (qRT-PCR)
Total RNA was isolated from mouse lung tissue using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). TRIzol was added to the lung tissue powder and allowed to stand at room temperature for 5 min. Subsequently, 200 μL of chloroform was added to each sample and vortexed. After a 5-min incubation, the samples were centrifuged at 12,000 rpm and 4 °C for 15 min. The upper aqueous phase was transferred, and 400 μL of isopropanol was added, followed by a 10-min incubation and centrifugation at 12,000 rpm and 4 °C for 10 min to collect the RNA pellet. The RNA pellet was washed with 70% ethanol, centrifuged, air-dried, and then resuspended in DEPC water. Finally, RNA concentration and purity were determined using UV spectrophotometry. Reverse transcription of total RNA was performed according to the instructions of the cDNA Reverse Transcription Kit. Quantitative PCR was carried out using SYBR Green (Beyotime Biotechnology, Shanghai, China) on a Roche LightCycler 480 real-time fluorescent quantitative PCR system. After completion of the reaction, the cycle threshold (Ct) values were determined, and the relative RNA levels of each sample were calculated using the 2
−ΔΔCt method, with normalization to β-actin levels. Primer sequences are provided in Table
1.
Flow cytometric analysis
Cell culture and treatment followed the same protocol as described above. Single-cell suspensions were prepared and fixed in 70% ethanol by volume. RNase A was added, followed by a 30-min incubation in a 37 °C water bath. Then, PI (Bestbio, Shanghai, China) staining was added, and mixed, and the samples were kept in the dark at 4 °C for 30 min. Flow cytometry (BD Celesta, USA) was conducted to record red fluorescence with an excitation wavelength of 488 nm.
Statistical analysis
Continuous variables are presented as mean ± standard deviation (SD). Overall significance was assessed using one-way ANOVA with GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA). A significance level of p < 0.05 was considered statistically significant when comparing differences between groups.
Discussion
In this study, we investigated the connection between RA-ILD and autophagy, as well as the underlying mechanism through which resveratrol reinstates autophagic flux via the AKT/TMEM175 pathway. Our findings demonstrated that resveratrol decreased the activation of the AKT/MEM175 complex by suppressing AKT expression. This, in turn, restored autophagic lysosomal fusion, mitigated fibrosis in RA-ILD, and reduced inflammation and oxidative stress levels. In this study, we employed an arthritis model induced by the combination of chicken type II collagen and Fuchs’ complete adjuvant. The model group exhibited elevated levels of TGF-β1, AKT, TMEM175, fibrosis, inflammation, and oxidation. Additionally, there impeded autophagic flux, which was alleviated by resveratrol treatment. In our in vitro cellular model, we stimulated MRC-5 cells with TGF-β1 + IL-1β to replicate RA-ILD conditions. Our experimental results indicated that both TGF-β1 and IL-1β treatments upregulated AKT expression and activated the AKT/MEM175 ion channel. This activation led to an increase in lysosomal H+ efflux and a hindrance in autophagic lysosomal fusion, which was counteracted by TMEM175 interference, ultimately alleviating fibrosis progression. In summary, our findings suggest that resveratrol diminishes inflammation and fibrosis in rheumatoid arthritis-associated interstitial lung disease by reinstating autophagic lysosomal flux through the AKT/TMEM175 pathway.
RA-ILD is a pulmonary condition resulting from an inflammatory response, which can lead to fibrosis and scarring of the lung interstitium, ultimately causing impaired lung function [
31‐
33]. Data indicates a decreasing overall mortality rate in RA, yet the mortality rate in RA-ILD seems to be steadily increasing over the years. The precise etiology of RA-ILD remains unknown; however, it is believed that the inflammatory response and abnormal immune system activation play significant roles in its pathogenesis [
34,
35]. In our study, we demonstrated elevated protein levels of IL-1β, TNF-α, SOD1, and SOD2 in RA-ILD. Furthermore, we observed a significant impairment in autophagic flux, increased expression of LC3-II and LAMP2, and substantial P62 accumulation in RA-ILD. This accumulation appeared to hinder autophagic lysosomal fusion and impede collagen degradation. These findings indicate that cellular autophagy plays a crucial role in the development of RA-ILD.
Resveratrol occurs naturally in certain plants and is a polyphenolic phytonutrient [
36,
37]. Resveratrol is recognized as a natural antioxidant that can combat damage caused by oxygen-free radicals, thereby reducing oxidative stress and inflammation [
38,
39]. Several studies propose that resveratrol may offer cardiovascular health benefits by potentially reducing cholesterol and blood pressure levels and preventing cardiovascular diseases like atherosclerosis [
40]. Resveratrol is also considered to possess anti-cancer potential, as it inhibits the proliferation and metastasis of cancer cells while promoting apoptosis [
41,
42]. Furthermore, resveratrol has demonstrated effectiveness in treating fibrosis in interstitial lung disease, as it mitigates the condition by reducing inflammation and oxidative stress level [
43,
44]. The aforementioned studies offer compelling evidence supporting the feasibility of using resveratrol in the treatment of RA-ILD. Our investigation revealed that resveratrol decreased the expression of proteins including IL-1β, TNF-α, SOD1, and SOD2. It also restored autophagic blockage and reduced the accumulation of P62 and Collagen I protein. These findings imply that resveratrol inhibited fibrosis, decreased inflammation, and alleviated oxidative stress in RA-ILD by reinstating autophagic flux.
Autophagy is a vital cellular process responsible for breaking down and eliminating waste and damaged cellular components, ensuring the stability of the cell’s internal environment. Recently, there has been increasing interest in researching the relationship between lung diseases and autophagy [
45]. Autophagy plays a role in conferring resistance to alveolar macrophage apoptosis and is implicated in the advancement of pulmonary fibrosis [
46]. Deficiency of PINK1 disrupts mitochondrial homeostasis and facilitates the development of lung fibrosis [
47]. Diosgenin mitigates inflammation and fibrosis in silica-induced lung conditions by enhancing autophagy in alveolar macrophages [
48]. In our current investigation, we observed a substantial accumulation of autophagic vesicles containing collagen. We also noted an increase in lysosomal expression, a reduction in acidic lysosomes in RA-ILD, and a blockade in autophagic lysosomal fusion. However, treatment with resveratrol restored autophagic lysosomal fusion, enhanced autophagic flux, and alleviated fibrosis in RA-ILD. These findings indicate that resveratrol plays a role in modulating autophagy and is implicated in the progression of RA-ILD.
TMEM175 (Transmembrane Protein 175) is a transmembrane protein located in lysosomal membranes, serving as an ion channel crucial for preserving lysosomal acidity. It has been demonstrated to collaborate with the V-ATPase enzyme in the regulation of luminal pH within lysosomes [
49]. Multiple studies indicate a potential link between TMEM175 and the onset of Parkinson’s disease [
27,
50]. Deficiency of TMEM175 disrupts both lysosomal and mitochondrial function and promotes the aggregation of alpha-synuclein [
51]. Moreover, TMEM175 may play a role in the progression of neurodegenerative diseases [
52]. These studies indicate that TMEM175 may play a role in disease regulation by influencing lysosomal function. In our current study, we observed up-regulation of AKT, TMEM175, and TGF-β1 in RA-ILD, which was accompanied by a reduction in autophagic lysosomal fusion and an increase in fibrosis. However, these effects were reversed with resveratrol treatment. We also discovered that TMEM175 can form a complex with AKT and is activated by TGF-β1, which is involved in regulating lysosomal pH. These findings suggest that resveratrol diminishes the activation of the AKT/MEM175 complex, maintains lysosomal pH stability, restores autophagic flux, and mitigates fibrosis in RA-ILD by inhibiting the expression of TGF-β1.
Nonetheless, our current study does have certain limitations. Firstly, our focus was primarily on investigating the impact of resveratrol on autophagy and fibrosis in RA-ILD, while the underlying mechanisms through which resveratrol mitigates inflammation and oxidative stress in RA-ILD have not been thoroughly explored. Secondly, our research concentrated solely on the effects of resveratrol on human embryonic lung cells, without assessing its influence on immune cells like alveolar macrophages. Thirdly, more comprehensive investigations are warranted to delve into the regulatory mechanisms by which resveratrol reinstates autophagic lysosomal fusion.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.