Skip to main content
Erschienen in: BMC Infectious Diseases 1/2024

Open Access 01.12.2024 | Research

Rapid, sensitive, and user-friendly detection of Pseudomonas aeruginosa using the RPA/CRISPR/Cas12a system

verfasst von: Wenjing Zhang, Hai Qu, Xin Wu, Jingjing Shi, Xinling Wang

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2024

Abstract

Background

Pseudomonas aeruginosa (P. aeruginosa) is a life-threatening bacterium known for its rapid development of antibiotic resistance, posing significant challenges in clinical treatment, biosecurity, food safety, and environmental monitoring. Early and accurate identification of P. aeruginosa is crucial for effective intervention.

Methods

The lasB gene of P. aeruginosa was selected as the target for the detection. RPA primers for recombinase polymerase amplification (RPA) and crRNA for CRISPR/Cas12a detection were meticulously designed to target specific regions within the lasB gene. The specificity of the RPA/CRISPR/Cas12a detection platform was assessed using 15 strains. The detection limit of RPA/CRISPR/Cas12a detection platform was determined by utilizing a pseudo-dilution series of the P. aeruginosa DNA. The practical applicability of the RPA/CRISPR/Cas12a detection platform was validated by comparing it with qPCR on 150 samples (35 processed meat product samples, 55 cold seasoned vegetable dishes, 60 bottled water samples).

Results

The RPA/CRISPR/Cas12a detection platform demonstrates high specificity, with no cross-reactivity with non-P. aeruginosa strains. This assay exhibits remarkable sensitivity, with a limit of detection (LOD) of 100 copies/µL for fluorescence assay and 101 copies/µL for the LFTS method. Furthermore, the performance of the RPA/CRISPR/Cas12a detection platform is comparable to that of the well-established qPCR method, while offering advantages such as shorter reaction time, simplified operation, and reduced equipment requirements.

Conclusions

The RPA/CRISPR/Cas12a detection platform presents a straightforward, accurate, and sensitive approach for early P. aeruginosa detection and holds great promise for diverse applications requiring rapid and reliable identification.
Begleitmaterial
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12879-024-09348-3.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Background

Pseudomonas aeruginosa (P. aeruginosa) belongs to the Pseudomonadaceae family and is a Gram-negative, aerobic, opportunistic pathogenic bacterium known for its remarkable adaptability and antibiotic resistance. It is ubiquitously found in various environments, encompassing both abiotic and biotic settings, including water, soil, animals, plants, as well as natural and artificial surroundings [1, 2]. P. aeruginosa wields an arsenal of virulence factors, such as endotoxin, exotoxin, proteolytic enzyme, and deploys diverse antimicrobial resistance mechanisms, including efflux pumps, antimicrobial-modifying enzymes, outer membrane permeability reduction, target modifications and more. Moreover, it exhibits the capacity to transition between different lifestyles, including planktonic, biofilm-based, and intracellular forms [3]. This adaptability enables it to activate, modify, and subvert host defense mechanism, evading immune system and antimicrobials agents, ultimately causing infections and diseases in both plants and animal hosts, including human [4]. In plants, P.aeruginosa can induce wet rot and leaf deformation [5], while in animals, it can lead to sepsis and respiratory infections, among other ailments [6]. In humans, P. aeruginosa poses a severe threat, particularly to individuals with compromised immune systems, such as those with severe burns, neutropenia, diabetes, organ transplants, cancer, and more. These infections are associated with substantial morbidity and mortality [7, 8]. Therefore, the early, rapid and accurate identification of P. aeruginosa is pivotal for effective clinical management, biosecurity, food safety, and environmental monitoring.
Currently, the detection of P. aeruginosa relies primarily on bacterial culture methods, immunological assays, and molecular analyses, among others. However, these methods exhibit certain limitations. Traditional bacterial culture methods, considered the gold standard for P. aeruginosa detection, are time-consuming, labor-intensive, and require strict conditions [9]. Immunological assays, reliant on antibodies, may yield false positives or negatives, undermining result accuracy. Molecular analyses, such as PCR-based methods, offer higher specificity and sensitivity for detecting P. aeruginosa. However, they require rigorous protocols, advanced equipment, and specialized training [10]. Consequently, there is an ongoing need to develop detection methods that are easier to operate and faster without compromising accuracy, to complement the existing molecular diagnostic techniques.
The clustered regularly interspaced short palindromic repeats (CRISPR) and the CRISPR - associated protein (CRISPR/Cas) system serves as an acquired immune system in bacteria and archaea, defending against mobile genetic elements invasions through rapid and precise identification and cleavage of specific nucleic acid sequences [11]. The CRISPR/Cas system has garnered significant attention in genetic engineering for its ability to swiftly, specifically, and efficiently recognize and cleave target nucleic acids [12]. In recent years, the CRISPR/Cas system, particularly utilizing Cas12 and Cas13 proteins with non-specific trans-cleavage activity, has emerged as a valuable tool in molecular detection, exemplified by platforms like SHERLOCK [13] and the HOLMES [14]. When the CRISPR/Cas system identifies and binds to the target sequences, it triggers the non-specific trans-cleavage activity of Cas12 or Cas13 proteins, leading to the cleavage of dual labeled single-stranded DNA (ssDNA) reporters, containing both a fluorescent maker and a quencher. This cleavage generates detectable or observable fluorescent signals [15]. Methods for detecting P. aeruginosa using the CRISPR/Cas12a system have been established by researchers [1620]. Through a comprehensive review of the current literature, we have developed a rapid, accurate, and user-friendly diagnostic test for identifying P. aeruginosa, termed the RPA/CRISPR/Cas12a detection platform.
In this assay, we have identified the lasB gene as the target for detecting P. aeruginosa [21]. The lasB gene, acknowledged as a pivotal virulence factor contributing to disease pathology in patients, has demonstrated remarkable suitability for RPA amplification, with notable sensitivity in RPA detection [2224]. Moreover, this gene is well-suited for assessing P. aeruginosa in clinical samples, as well as for monitoring the existence of this pathogen in drinking water, foodstuffs, and environmental samples [25].
Our detection platform combines the precision of the CRISPR/Cas12a mechanism with the efficiency of RPA isothermal amplification, thereby simplifying the detection process and significantly reducing the time required for precise pathogen identification. This assay’ s utility is especially advantageous in resource-limited settings, providing an effective means for early intervention and management of infections caused by P. aeruginosa.
Consequently, our research findings contribute to further enhancing the potential of the lasB gene for developing advanced diagnostic tools specifically targeting P. aeruginosa.

Methods

Reagents and instruments

The Isothermal DNA Amplification Basic Kit for RPA was sourced from EZassay Ltd. (Shenzhen, China). LbaCas12a enzyme and its corresponding reaction buffer were purchased from New England Biolabs (Ipswich, MA, USA). The TIANamp Bacteria DNA kit was sourced from Tiangen Biotech Co., Ltd (Beijing, China). Ultrapure water (dd H2O) was purchased from Thermo Fisher Scientific (Shanghai, China). RPA primers, crRNA and the ssDNA reporters (fluorescence assay: 5′ FAM - TTATT - BHQ1 3′, lateral flow test strip (LFTS) method: 5′ FITC - TTTTTTTTTT - Biotin 3′) were custom-synthesized by Sangon Biotech Co.,Ltd (Shanghai, China). The ABI 7500 fast system was purchased from Applied Biosystems (Foster City, CA, United States). Lateral flow strips were obtained from Tiosbio (Beijing, China) and their principle is illustrated in Fig. 1. The test strip’s conjugate pad was coated with complexes of gold nanoparticles and anti-FITC antibody. Streptavidin (SA) and goat anti-mouse IgG were immobilized on the NC membrane at the positions corresponding of the C line and the T line, respectively (Fig. 1B). In the absence of the target, the trans-cleavage activity of Cas12a remained inactive, keeping the ssDNA reporters intact (Fig. 1A). Complete ssDNA reporters, along with complexes of gold nanoparticle and anti-FITC antibody, were captured by SA on the C line, resulting in the visibility of the C line while the T line invisible (Fig. 1C). In the presence of the target, the trans-cleavage activity of Cas12a was activated, leading to the separation of FITC and biotin molecules within the ssDNA reporters. FITC-anti-FITC antibody-gold nanoparticle complexes were captured by the goat anti-mouse IgG on the T line, rendering the T line visible, with no change to the visibility of the C line (Fig. 1D).

Bacteria culture and DNA extraction

A standard P. aeruginosa strain, four clinically isolated P. aeruginosa strains, and ten non - P. aeruginosa strains were generously provided by Autobio Diagnostics Co., Ltd. Detailed information on the strains used in this study is presented in Table 1. The bacterial strains were stored in Luria-Bertani (LB) broth supplemented with 20% glycerol at -70℃. When required, the preserved bacteria were streaked onto agar plates and incubated at 37℃ for 24 h. Single colonies were picked and further incubated at 37℃ for 24 h. The bacterial suspension was subsequently standardized to a final concentration of 1 × 105 CFU/mL for subsequent experimental procedures. Genomic DNA was extracted from these bacterial cultures using the TIANamp Bacteria DNA kit for all experiments except sensitivity analysis, following the standard manufacturer’s instructions.
Table 1
Information of bacteria strains
Bacteria strain
Source
P. aeruginosa
ATCC27853
P. aeruginosa
ATTL2104080901
P. aeruginosa
ATTL2104080902
P. aeruginosa
ATTL2104080903
P. aeruginosa
ATTL2104080904
P. stutzeri
CTCC23621
P. putida
CTCC20575
P. alcaligenes
CICC23927
P. fluorescens
CTCC23919
Staphylococcus aureus
ATCC29213
Escherichia coli
ATCC25922
Shigella flexner
ATCC12022
Listeria monocytogenes
ATCC19118
Salmonella typhimurium
ATCC14028
Bacillus subtilis
ATCC19659

RPA primer and crRNA design

For the detection of P. aeruginosa, the lasB gene was selected as the target due to its significant intraspecific conservation and notable interspecific similarity, as observed in the genome sequences of P. aeruginosa from GenBank. To ensure specificity, RPA primers and crRNA were meticulously designed to target specific regions within the lasB gene. The design locations for the RPA primers and crRNA are visually represented in Fig. 2, and the sequences of these primers and crRNA can be found in Table 2.
Table 2
The sequences of the primers and crRNA
Application
sequence
RPA primer
Forward 5′ GAAGGTTTCTACGCTTGACCTGTTGTTCGT 3′
Reverse 5′ GTTGTGGAATTGCTCGTAGCGGGTGACCTG 3′
crRNA
crRNA1 5′ UAAUUUCUACUAAGUGUAGAUAGUUCGUCGGCACCGCCAGCGCC 3′
crRNA2 5′ UAAUUUCUACUAAGUGUAGAUCCGCCGACCUGAUCGACGUGUCC 3′

RPA reaction

The RPA amplification was conducted using the Isothermal DNA Amplification Basic Kit following the manufacturer’s standard instructions. The amplification system (20µL) comprised the following components: Rehydration Buffer (2X) 10µL, Forward Primer (20µM) 0.5µL, Reverse Primer (20µM) 0.5µL, DNA template 1µL, ddH2O 6µL, and Starter (10X) 2µL. The mixture was gently mixed by flicking and centrifuged at low speed for 10 s, repeat this step three times. The reaction system was then incubated at 39℃ for various duration, including 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, to determine the optimal incubation time. As a negative control, ddH2O was used.

Screening of crRNA

To identify the crRNA for CRISPR/Cas12a detection, crRNA1 and crRNA2 were separately introduced into the CRISPR/Cas12a detection reaction system, followed by the observation of fluorescence intensity. The reaction system (40µL) consisted of the following components: 10µL reaction buffer (4X), 1µL Reporter (4µM, 5′ FAM – TTATT - BHQ1 3′), 2µL Cas12a Protein (1µM), 2µL crRNA (1µM), and 23µL ddH2O, pre-mixed accordingly. Subsequently, 2µL of RPA amplification products were added and thoroughly mixed. The reaction tube was immediately transferred to a Real-time fluorescence PCR instrument. The fluorescence resulting from the Cas12a cleavage reaction was continuously collected using the ABI fast 7500 system. Background-subtracted fluorescence was determined by subtracting the background fluorescence (without template) from the initial fluorescence of all samples. Subsequently, the background subtracted fluorescence intensities were compared under the same reaction conditions to select the optimal crRNA and reaction time based on the results obtained.

CRISPR/Cas12a detection

Both fluorescence assay and the LFTS method were employed for the detection of the amplified P. aeruginosa DNA. In the fluorescence assay, the reaction system and specific operational steps were consistent with those used for crRNA screening, with the only difference being the use of the optimal crRNA. Real-time fluorescence values were collected using the ABI 7500 Fast system. Regarding the LFTS method, the reaction system was the same as that of the fluorescence assay, except that 5′ FITC - TTTTTTTTTT - Biotin 3′ was used instead of 5′ FAM - TTATT - BHQ1 3′ as the reporter. After thorough mixing of the mixture, the reaction incubated at 37℃ for the optimal reaction time selected. Subsequently, the reaction product was dripped onto the sample end of the test strip, followed by observation of the T line and C line.

Evaluation of specificity of RPA/CRISPR/Cas12a detection platform

The specificity of the RPA/CRISPR/Cas12a detection platform was assessed using a range of strains as listed in Table 1. This included 1 standard strain of P. aeruginosa, 4 clinically isolated of P. aeruginosa, 4 Pseudomonas strains closely related to P. aeruginosa, and 6 non-Pseudomonas strains. Each strain was individually subjected to detection using the RPA/CRISPR/Cas12a platform at a concentration of 1 × 105 CFU/mL. The assays were performed three times, following the methodology described above.

Evaluation of the sensitivity of RPA/CRISPR/Cas12a detection platform

To assess the sensitivity of RPA/CRISPR/Cas12a detection platform, a recombinant plasmid containing the lasB target sequence (pGEM - T Easy - lasB) was subjected to continuous 10 - fold dilution, ranging from 106 to 100 copies/µL. Subsequently, the differently diluted DNA samples were used as templates to determine LOD. All assays were replicated 3 times using the aforementioned methodology.

Validating the effectiveness of RPA/CRISPR/Cas12a detection platform with Food samples

To validate the practical applicability of the RPA/CRISPR/Cas12a detection platform, a total of 150 diverse food samples were analyzed, including processed meat products, cold seasoned vegetable dishes from nearby markets, and college-provided bottled water. Specific methods for sample processing are referenced in the literature [26]. Additionally, for a comprehensive comparison, these samples were concurrently subjected to detection using qPCR. In particular, qPCR was executed in a 25µL volume with 12.5µL of 2×SYBR Green PCR mix, 2µL of each primer at 1 µM concentration, 1µL of DNA template, and 7.5µL ddH2O. The PCR program began with a 10-minute denaturation at 95℃, followed by 40 cycles at 95℃ for 15 s for denaturation, and annealing/extension at 60℃ for 30 s, using primers described in prior literature [21]. Each assay was performed in triplicate, adhering strictly to the described protocol.

Statistical analysis

Statistical analyses were performed using SPSS 21.0 (IBM SPSS 21.0, SPSS, Inc., Chicago, IL, USA). A Studentʼs t test was employed for the comparisons between two groups. All data were presented as mean ± SD. Statistical significance was set as P < 0.05. Each experiment was performed in triplicate.

Results

Optimal crRNA for CRISPR/Cas12a detection

The RPA product, amplified at the optimal reaction time of 15 min, was employed as the template for screening crRNA in the CRISPR/Cas12a detection. crRNA1 and crRNA2 were separately introduced into the reaction system, and the background-subtracted fluorescence values were compared between the crRNA1 and the crRNA2 groups. As illustrated in Fig. 3, the fluorescence values of the crRNA1 group were higher than those of the crRNA2 group (P < 0.05), establishing crRNA1 as the optimal choice for CRISPR/Cas12a detection. Additionally, Fig. 3 demonstrates that the fluorescence values of the crRNA1 group were consistently higher than the crRNA2 group throughout the duration of the reaction. The fluorescence curve analysis further revealed that background-subtracted fluorescence reached a plateau after approximately 15 min, confirming 15 min as the optimal reaction time for the CRISPR/Cas12a detection method.

Specificity of RPA/CRISPR/Cas12a detection platform

The RPA/CRISPR/Cas12a detection platform was employed to assess 15 bacteria strains (Table 1). The fluorescence assay results demonstrated that there was a significant increase in fluorescence values for the P. aeruginosa standard strain and four clinically isolated strains of P. aeruginosa (P<0.05), while fluorescence values remained relatively unchanged for other non-P. aeruginosa strains (Fig. 4A). The outcomes from the LFTS method were consistent with those of the fluorescence assay, showing positive results exclusively for the P. aeruginosa standard strain and 4 P. aeruginosa clinically isolated strains (Fig. 4B). These results confirmed the high specificity of the RPA/CRISPR/Cas12a detection platform in accurately identifying P. aeruginosa.

Sensitivity of the RPA/CRISPR/Cas12a detection platform

To assess the sensitivity of the RPA/CRISPR/Cas12a detection platform, a recombinant plasmid containing the lasB target sequence (pGEM - T Easy - lasB) was subjected to serial 10-fold dilutions, ranging from 106 to 100 copies/µL. Each diluted sample was analyzed using the RPA/CRISPR/Cas12a detection platform to determine the LOD, with ddH2O serving as the negative control. As depicted in Fig. 5, a significant fluorescence signal was observed using fluorescence assay when the DNA concentration exceeded 100 copies/µL (P<0.05). Interestingly, the results obtained from the LFTS method were generally consistent with those of the fluorescence assay.The appearance of T line was observed at a concentration of 101 copies/µL and above. Among the positive results, both the T line and C line became visible at a concentration of 101 copies/µL, it is speculated that the trans-cleavage activity of Cas12a was insufficiently activated due to the low DNA concentration, resulting in only a portion of ssDNA reporters were trans-cleaved. Consequently, the ssDNA reporter-gold nanoparticle-anti-FITC antibody complexes were captured on the C line, while the FITC-anti-FITC antibody-gold nanoparticle complexes were captured on the T line, making both the T line and C line visible. These results indicate that RPA/CRISPR/Cas12a detection platform exhibits high sensitivity, with a LOD of 100 copies/µL for fluorescence assay and 101 copies/µL for the LFTS method.

Application of the RPA/CRISPR/Cas12a detection platform

To evaluate the applicability of RPA/CRISPR/Cas12a detection platform, a total of 150 samples were tested using both qPCR and the RPA/CRISPR/Cas12a detection platform. The results obtained from the fluorescence assay and the LFTS method were compared with the results of the qPCR assay. The findings are presented in Table 3, demonstrating that the results of both the fluorescence assay and the LFTS method were generally consistent with the qPCR assay. This suggests that the performance of the RPA/CRISPR/Cas12a detection platform is comparable to that of qPCR. One notable advantage of the RPA/CRISPR/Cas12a detection platform is its ability to deliver results in a shorter time and at isothermal temperature compared to qPCR. Consequently, the RPA/CRISPR/Cas12a detection platform offers a convenient and efficient alternative for pathogen detection.
Table 3
Comparison of RPA/CRISPR/Cas12a detection platform with qPCR
Sample
Detection method
Positive
Negative
Total
Detection rate(%)
Processed meat products
Fluorescence assay
4
31
35
11.43
The LFTS method
3
32
35
8.57
qPCR
4
31
35
11.43
Cold seasoned vegetable dishes
Fluorescence assay
9
46
55
16.36
The LFTS method
9
46
55
16.36
qPCR
10
45
55
18.18
Bottled water
Fluorescence assay
2
58
60
3.33
The LFTS method
1
59
60
1.67
qPCR
2
58
60
3.33

Discussion

P. aeruginosa, renowned for its multidrug resistance and association with high mortality rate, has prompted extensive research on early and rapid detection methods. Among these methods, molecular analyses, especially PCR-based approaches, have gained popularity for their high sensitivity and specificity in detecting in P. aeruginosa. Various target genes have been employed in PCR-based methods for P. aeruginosa detection, including lasB gene [25], gyrB gene [27, 28], oprl gene [29, 30] ecfX gene [31, 32], among others. Through bioinformatics analysis, it was determined that the lasB gene exhibits high intraspecific conservation and significant interspecific dissimilarity, making it a promising target for detection. Furthermore, as a key virulence factor, the lasB gene has potential applications in anti-virulence treatments [21].
In this study, the selection of the lasB gene as the target for the RPA/CRISPR/Cas12a detection platform exhibited exceptional specificity. It successfully identified both the standard strain and clinically isolated strains of P. aeruginosa without cross-reactivity to non - P. aeruginosa strains. This outcome is consistent with the findings reported by Yang et al. [20], aligning with the bioinformatics analysis. Additionally, the platform exhibited excellent sensitivity, with LOD of 100 copies/µL and 101 copies/µL for the fluorescence assay and LFTS method, respectively. This is in line with the findings of Yang et al. [20], who identified an LOD of 15.9 CFU/reaction in their methodology, further validating suitability of the lasB gene as a target for P. aeruginosa detection.
The RPA/CRISPR/Cas12a detection platform employs RPA for isothermal DNA amplification of P. aeruginosa DNA, offering a user-friendly operation. The designed primers allowed the amplification product to reach a plateau within 15 min, indicating the detection platform’s rapidity and efficiency. By utilizing crRNA1 in the CRISPR/Cas12a detection, the fluorescence signal can reach approximately 80% of the maximum value within 10 min, allowing the platform to yield results in a remarkably short period of approximately 15 min. Combined with the RPA reaction duration, the entire detection process of the RPA/CRISPR/Cas12a detection platform can be completed in approximately 30 min. Moreover, the LFTS method is notably less complex and easier to operate, and it generally results in shorter testing times.
In practical sample evaluation, the detection rates of the RPA/CRISPR/Cas12a detection platform and qPCR detection are comparable. Both detection methods in the platform demonstrated robustness, with the LFTS method providing visible results without complex equipment, making it well-suited for on-site testing in settings where instruments may be lacking. On the other hand, the fluorescence assay, while more complex and requiring specific instruments, demonstrated higher sensitivity. Notwithstanding, the advent of portable fluorescence analyzers has mitigated such limitation, allowing for easy and rapid detection.
While our study displays the advantages of simplicity, rapidity, and sensitivity in detecting P. aeruginosa, it is not without significant constraints. Employing a single-gene detection strategy introduces a potential for false-negative results due to genetic variations. To expedite detection, we chose to shorten RPA amplification times, but this might miss extremely low DNA concentrations, thereby increasing the risk of false negatives and potentially reducing the sensitivity of our detection system. Furthermore, ethical constraints prevented the incorporation of clinical samples, a significant limitation to the direct clinical relevance of our findings. Employing dual or multiple genetic targets for detection might enhance accuracy, while integrating internal controls could bolster the system’s reliability. Nevertheless, the optimization and design of such a multi-target detection approach require sustained exploration and concerted effort in future research.

Conclusion

This study has established a rapid and efficient method for the detection of P. aeruginosa, with broad applications in areas including the prevention and treatment of P. aeruginosa infection, food safety, environmental detection, and beyond. This method can significantly contribute to overall safety and the mitigation of potential risks associated with P. aeruginosa.

Declarations

This article does not address ethical review issues.
Not applicable.

Conflict of interest

The authors declare that they have no conflicts of interest.

Competing interests

The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Anhänge

Electronic supplementary material

Below is the link to the electronic supplementary material.
Literatur
1.
Zurück zum Zitat Crone S, Vives-Flórez M, Kvich L, Saunders AM, Malone M, Nicolaisen MH, Martínez-García E, Rojas-Acosta C, Gomez-Puerto MC, Calum H, Whiteley M, Kolter R, Bjarnsholt T. The environmental occurrence of Pseudomonas aeruginosa. APMIS. 2020;128(3):220–31.CrossRefPubMed Crone S, Vives-Flórez M, Kvich L, Saunders AM, Malone M, Nicolaisen MH, Martínez-García E, Rojas-Acosta C, Gomez-Puerto MC, Calum H, Whiteley M, Kolter R, Bjarnsholt T. The environmental occurrence of Pseudomonas aeruginosa. APMIS. 2020;128(3):220–31.CrossRefPubMed
2.
Zurück zum Zitat Horcajada JP, Montero M, Oliver A, Sorlí L, Luque S, Gómez-Zorrilla S, Benito N, Grau S. Epidemiology and treatment of multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa infections. Clin Microbiol Rev. 2019;32(4):e00031–19.CrossRefPubMedPubMedCentral Horcajada JP, Montero M, Oliver A, Sorlí L, Luque S, Gómez-Zorrilla S, Benito N, Grau S. Epidemiology and treatment of multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa infections. Clin Microbiol Rev. 2019;32(4):e00031–19.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Qin SG, Xiao W, Zhou CM, Pu QQ, Deng X, Lan LF, Liang HH, Song XR, Wu M. Pseudomonas aeruginosa: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct Target Ther. 2022;7(1):199.CrossRefPubMedPubMedCentral Qin SG, Xiao W, Zhou CM, Pu QQ, Deng X, Lan LF, Liang HH, Song XR, Wu M. Pseudomonas aeruginosa: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct Target Ther. 2022;7(1):199.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Jurado-Martín I, Sainz-Mejías M, McClean S. Pseudomonas aeruginosa: An Audacious Pathogen with an adaptable Arsenal of virulence factors. Int J Mol Sci. 2021;22(6):3128.CrossRefPubMedPubMedCentral Jurado-Martín I, Sainz-Mejías M, McClean S. Pseudomonas aeruginosa: An Audacious Pathogen with an adaptable Arsenal of virulence factors. Int J Mol Sci. 2021;22(6):3128.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Marei EM. Isolation and characterization of Pseudomonas aeruginosa and its virulent bacteriophages. Pak J Biol Sci. 2020;23(4):491–500.CrossRefPubMed Marei EM. Isolation and characterization of Pseudomonas aeruginosa and its virulent bacteriophages. Pak J Biol Sci. 2020;23(4):491–500.CrossRefPubMed
6.
Zurück zum Zitat Zhang BS, Li LJ, Zhu Q, Wang Z, Yuan P, Zhou GD, Shi WJ, Chu XF, Jiang SJ, Xie ZJ. Co-infection of H9N2 influenza virus and Pseudomonas aeruginosa contributes to the development of hemorrhagic pneumonia in mink. Vet Microbiol. 2020;240:108542.CrossRef Zhang BS, Li LJ, Zhu Q, Wang Z, Yuan P, Zhou GD, Shi WJ, Chu XF, Jiang SJ, Xie ZJ. Co-infection of H9N2 influenza virus and Pseudomonas aeruginosa contributes to the development of hemorrhagic pneumonia in mink. Vet Microbiol. 2020;240:108542.CrossRef
7.
Zurück zum Zitat Azam MW, Khan AU. Updates on the pathogenicity status of Pseudomonas aeruginosa. Drug Discov Today. 2019;24(1):350–9.CrossRefPubMed Azam MW, Khan AU. Updates on the pathogenicity status of Pseudomonas aeruginosa. Drug Discov Today. 2019;24(1):350–9.CrossRefPubMed
8.
9.
Zurück zum Zitat Váradi L, Luo JL, Hibbs DE, Perry JD, Anderson RJ, Orenga S, Groundwater PW. Methods for the detection and identification of pathogenic bacteria: past, present, and future. Chem Soc Rev. 2017;46(16):4818–32.CrossRefPubMed Váradi L, Luo JL, Hibbs DE, Perry JD, Anderson RJ, Orenga S, Groundwater PW. Methods for the detection and identification of pathogenic bacteria: past, present, and future. Chem Soc Rev. 2017;46(16):4818–32.CrossRefPubMed
10.
Zurück zum Zitat Zheng X, Gao SX, Wu JH, Hu XB. Recent advances in aptamer-based biosensors for detection of pseudomonas aeruginosa. Front Microbiol. 2020;11:605229.CrossRefPubMedPubMedCentral Zheng X, Gao SX, Wu JH, Hu XB. Recent advances in aptamer-based biosensors for detection of pseudomonas aeruginosa. Front Microbiol. 2020;11:605229.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Duan L, Yang XH, Zhan WL, Tang Y, Wei MG, Chen KY, Liu P, Xie J, Zhang CB, Zhao HY, Luo MY. Development of a rapid and accurate CRISPR/Cas13 - based diagnostic test for GII.4 norovirus infection. Front Microbiol. 2022;13:912315.CrossRefPubMedPubMedCentral Duan L, Yang XH, Zhan WL, Tang Y, Wei MG, Chen KY, Liu P, Xie J, Zhang CB, Zhao HY, Luo MY. Development of a rapid and accurate CRISPR/Cas13 - based diagnostic test for GII.4 norovirus infection. Front Microbiol. 2022;13:912315.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Zhu CS, Liu CY, Qiu XY, Xie SS, Li WY, Zhu L, Zhu LY. Novel nucleic acid detection strategies based on CRISPR-Cas systems: from construction to application. Biotechnol Bioeng. 2020;17(7):2279–94.CrossRef Zhu CS, Liu CY, Qiu XY, Xie SS, Li WY, Zhu L, Zhu LY. Novel nucleic acid detection strategies based on CRISPR-Cas systems: from construction to application. Biotechnol Bioeng. 2020;17(7):2279–94.CrossRef
13.
Zurück zum Zitat Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung JL, Verdine V, Donghia N, Daringer NM, Freije CA, Myhrvold C, Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 2017;356(6336):438–42.CrossRefPubMedPubMedCentral Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung JL, Verdine V, Donghia N, Daringer NM, Freije CA, Myhrvold C, Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 2017;356(6336):438–42.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Li SY, Cheng QX, Wang JM, Li XY, Zhang ZL, Gao S, Cao RB, Zhao GP, Wang J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018;4:20.CrossRefPubMedPubMedCentral Li SY, Cheng QX, Wang JM, Li XY, Zhang ZL, Gao S, Cao RB, Zhao GP, Wang J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018;4:20.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Mukama O, Wu JH, Li ZY, Liang QX, Yi ZJ, Lu XW, Liu YJ, Liu YM, Hussain M, Makafe GG, Liu JX, Xu N, Zeng LW. An ultrasensitive and specific point-of-care CRISPR/Cas12 based lateral flow biosensor for the rapid detection of nucleic acids. Biosens Bioelectron. 2020;159:112143.CrossRefPubMed Mukama O, Wu JH, Li ZY, Liang QX, Yi ZJ, Lu XW, Liu YJ, Liu YM, Hussain M, Makafe GG, Liu JX, Xu N, Zeng LW. An ultrasensitive and specific point-of-care CRISPR/Cas12 based lateral flow biosensor for the rapid detection of nucleic acids. Biosens Bioelectron. 2020;159:112143.CrossRefPubMed
16.
Zurück zum Zitat Chen Y, Mei YX, Zhao XH, et al. Reagents-loaded, automated assay that integrates recombinase-aided amplification and Cas12a nucleic acid detection for a point-of-care test. Anal Chem. 2020;92(21):14846–52.CrossRefPubMed Chen Y, Mei YX, Zhao XH, et al. Reagents-loaded, automated assay that integrates recombinase-aided amplification and Cas12a nucleic acid detection for a point-of-care test. Anal Chem. 2020;92(21):14846–52.CrossRefPubMed
17.
Zurück zum Zitat Liu S, Huang SY, Li F, et al. Rapid detection of Pseudomonas aeruginosa by recombinase polymerase amplification combined with CRISPR-Cas12a biosensing system. Front Cell Infect Microbiol. 2023;13:1239269.CrossRefPubMedPubMedCentral Liu S, Huang SY, Li F, et al. Rapid detection of Pseudomonas aeruginosa by recombinase polymerase amplification combined with CRISPR-Cas12a biosensing system. Front Cell Infect Microbiol. 2023;13:1239269.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Huang SY, Wang XF, Chen XC, et al. Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection. Sci Rep. 2023;13(1):19199.CrossRefPubMedPubMedCentral Huang SY, Wang XF, Chen XC, et al. Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection. Sci Rep. 2023;13(1):19199.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Hu JC, Liang L, He MF, et al. Sensitive and direct analysis of pseudomonas aeruginosa through self-primer-assisted chain extension and CRISPR-Cas12a-based color reaction. ACS Omega. 2023;8(38):34852–8.CrossRefPubMedPubMedCentral Hu JC, Liang L, He MF, et al. Sensitive and direct analysis of pseudomonas aeruginosa through self-primer-assisted chain extension and CRISPR-Cas12a-based color reaction. ACS Omega. 2023;8(38):34852–8.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Yang HT, Liu AB, Ma FF, et al. Establishment of portable Pseudomonas aeruginosa detection platform based on one-tube CRISPR/Cas12a combined with recombinase polymerase amplification technology. Clin Chim Acta. 2024;554:117760.CrossRefPubMed Yang HT, Liu AB, Ma FF, et al. Establishment of portable Pseudomonas aeruginosa detection platform based on one-tube CRISPR/Cas12a combined with recombinase polymerase amplification technology. Clin Chim Acta. 2024;554:117760.CrossRefPubMed
21.
Zurück zum Zitat Everett MJ, Davies DT. Pseudomonas aeruginosa elastase (lasB) as a therapeutic target. Drug Discov Today. 2021;26(9):2108–23.CrossRefPubMed Everett MJ, Davies DT. Pseudomonas aeruginosa elastase (lasB) as a therapeutic target. Drug Discov Today. 2021;26(9):2108–23.CrossRefPubMed
22.
Zurück zum Zitat Jin XJ, Gong YL, Yang L, et al. Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa. Zhonghua Shao Shang Za Zhi. 2018;34(4):233–9.PubMed Jin XJ, Gong YL, Yang L, et al. Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa. Zhonghua Shao Shang Za Zhi. 2018;34(4):233–9.PubMed
23.
Zurück zum Zitat Tran DH, Tran HT, Pham TNM, Phung HTT. Direct multiplex recombinase polymerase amplification for rapid detection of S taphylococcus aureus and Pseudomonas aeruginosa in food. Mol Biol Res Commun. 2022;11(1):1–10.PubMedPubMedCentral Tran DH, Tran HT, Pham TNM, Phung HTT. Direct multiplex recombinase polymerase amplification for rapid detection of S taphylococcus aureus and Pseudomonas aeruginosa in food. Mol Biol Res Commun. 2022;11(1):1–10.PubMedPubMedCentral
24.
Zurück zum Zitat Raja B, Goux HJ, Marapadaga A, Rajagopalan S, Kourentzi K, Willson RC. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens. J Appl Microbiol. 2017;123(2):544–55.CrossRefPubMedPubMedCentral Raja B, Goux HJ, Marapadaga A, Rajagopalan S, Kourentzi K, Willson RC. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens. J Appl Microbiol. 2017;123(2):544–55.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Yang HT, Wang Y, Yang QK, Fan H, Wang L, Zhang TM, Li ZX, Liu G, Zhao PP, Wu HH, Dong JQ, Liang W. A rapid and sensitive detection method for Pseudomonas aeruginosa using visualized recombinase polymerase amplification and lateral flow strip technology. Front Cell Infect Microbiol. 2021;11:698929.CrossRefPubMedPubMedCentral Yang HT, Wang Y, Yang QK, Fan H, Wang L, Zhang TM, Li ZX, Liu G, Zhao PP, Wu HH, Dong JQ, Liang W. A rapid and sensitive detection method for Pseudomonas aeruginosa using visualized recombinase polymerase amplification and lateral flow strip technology. Front Cell Infect Microbiol. 2021;11:698929.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Stratakos AC, Linton M, Millington S, Grant IR. A loop-mediated isothermal amplification method for rapid direct detection and differentiation of nonpathogenic and verocytotoxigenic Escherichia coli in beef and bovine faeces. J Appl Microbiol. 2017;122(3):817–28.CrossRefPubMed Stratakos AC, Linton M, Millington S, Grant IR. A loop-mediated isothermal amplification method for rapid direct detection and differentiation of nonpathogenic and verocytotoxigenic Escherichia coli in beef and bovine faeces. J Appl Microbiol. 2017;122(3):817–28.CrossRefPubMed
27.
Zurück zum Zitat Golpayegani A, Nodehi RN, Rezaei F, Alimohammadi M, Douraghi M. Real-time polymerase chain reaction assays for rapid detection and virulence evaluation of the environmental Pseudomonas aeruginosa isolates. Mol Biol Rep. 2019;46(4):4049–61.CrossRefPubMed Golpayegani A, Nodehi RN, Rezaei F, Alimohammadi M, Douraghi M. Real-time polymerase chain reaction assays for rapid detection and virulence evaluation of the environmental Pseudomonas aeruginosa isolates. Mol Biol Rep. 2019;46(4):4049–61.CrossRefPubMed
28.
Zurück zum Zitat Cabrera R, Fernández-Barat L, Vázquez N, Alcaraz-Serrano V, Bueno-Freire L, Amaro R, López-Aladid R, Oscanoa P, Muñoz L, Vila J. Torres. Resistance mechanisms and molecular epidemiology of Pseudomonas aeruginosa strains from patients with bronchiectasis. J Antimicrob Chemother. 2022;77(6):1600–10.CrossRefPubMedPubMedCentral Cabrera R, Fernández-Barat L, Vázquez N, Alcaraz-Serrano V, Bueno-Freire L, Amaro R, López-Aladid R, Oscanoa P, Muñoz L, Vila J. Torres. Resistance mechanisms and molecular epidemiology of Pseudomonas aeruginosa strains from patients with bronchiectasis. J Antimicrob Chemother. 2022;77(6):1600–10.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Li DX, Shu GL, Wang WJ, Wu Y, Niu HC. Simple, rapid and sensitive detection of Pseudomonas aeruginesa by colorimetric multiple cross displacement amplification. Curr Med Sci. 2020;40(2):372–9.CrossRefPubMed Li DX, Shu GL, Wang WJ, Wu Y, Niu HC. Simple, rapid and sensitive detection of Pseudomonas aeruginesa by colorimetric multiple cross displacement amplification. Curr Med Sci. 2020;40(2):372–9.CrossRefPubMed
30.
Zurück zum Zitat Dong K, Kang ZM, Ji X, Zhang XX, Cheng PN, Sun B. A Loop-mediated isothermal amplification with a nanoparticle-based lateral flow biosensor assay to detect Pseudomonas aeruginosa in Endophthalmitis. Transl Vis Sci Techno. 2021;10(14):26.CrossRef Dong K, Kang ZM, Ji X, Zhang XX, Cheng PN, Sun B. A Loop-mediated isothermal amplification with a nanoparticle-based lateral flow biosensor assay to detect Pseudomonas aeruginosa in Endophthalmitis. Transl Vis Sci Techno. 2021;10(14):26.CrossRef
31.
Zurück zum Zitat Xie GY, Yu S, Li W, Mu D, Aguilar ZP, Xu HY. Simultaneous detection of Salmonella spp, Pseudomonas aeruginosa, Bacillus cereus, and Escherichia coli O157: H7 in environmental water using PMA combined with mPCR. J Microbiol. 2020; 58(8): 668–674. Xie GY, Yu S, Li W, Mu D, Aguilar ZP, Xu HY. Simultaneous detection of Salmonella spp, Pseudomonas aeruginosa, Bacillus cereus, and Escherichia coli O157: H7 in environmental water using PMA combined with mPCR. J Microbiol. 2020; 58(8): 668–674.
32.
Zurück zum Zitat Manajit O, Longyant S, Sithigorngul P, Chaivisuthangkura P. Development of uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification coupled with nanogold probe (UDG-LAMP-AuNP) for specific detection of Pseudomonas aeruginosa. Mol Med Rep. 2018;17(4):5734–43.PubMedPubMedCentral Manajit O, Longyant S, Sithigorngul P, Chaivisuthangkura P. Development of uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification coupled with nanogold probe (UDG-LAMP-AuNP) for specific detection of Pseudomonas aeruginosa. Mol Med Rep. 2018;17(4):5734–43.PubMedPubMedCentral
Metadaten
Titel
Rapid, sensitive, and user-friendly detection of Pseudomonas aeruginosa using the RPA/CRISPR/Cas12a system
verfasst von
Wenjing Zhang
Hai Qu
Xin Wu
Jingjing Shi
Xinling Wang
Publikationsdatum
01.12.2024
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2024
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-024-09348-3

Weitere Artikel der Ausgabe 1/2024

BMC Infectious Diseases 1/2024 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Erhebliches Risiko für Kehlkopfkrebs bei mäßiger Dysplasie

29.05.2024 Larynxkarzinom Nachrichten

Fast ein Viertel der Personen mit mäßig dysplastischen Stimmlippenläsionen entwickelt einen Kehlkopftumor. Solche Personen benötigen daher eine besonders enge ärztliche Überwachung.

Nach Herzinfarkt mit Typ-1-Diabetes schlechtere Karten als mit Typ 2?

29.05.2024 Herzinfarkt Nachrichten

Bei Menschen mit Typ-2-Diabetes sind die Chancen, einen Myokardinfarkt zu überleben, in den letzten 15 Jahren deutlich gestiegen – nicht jedoch bei Betroffenen mit Typ 1.

15% bedauern gewählte Blasenkrebs-Therapie

29.05.2024 Urothelkarzinom Nachrichten

Ob Patienten und Patientinnen mit neu diagnostiziertem Blasenkrebs ein Jahr später Bedauern über die Therapieentscheidung empfinden, wird einer Studie aus England zufolge von der Radikalität und dem Erfolg des Eingriffs beeinflusst.

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.