Introduction
TP, encoded by
TYMP, is a cytosolic metabolic enzyme that degrades thymidine (dThd) or deoxyuridine (dUrd) to thymine or uracil. Inherited deficiency of
TYMP causes an autosomal recessive disease with mtDNA abnormalities called MNGIE, which is a rare, progressive and fatal disease that mainly affects the gastrointestinal and neurological systems [
1]. Previous research has suggested that the mtDNA defects in MNGIE are due to an imbalance of the mitochondrial nucleotide pool caused by mitochondrial accumulation of dThd/dUrd and corresponding nucleotides [
2]. Unlike primary mitochondrial diseases, which are caused by defects in mitochondrial proteins encoded by nuclear or mitochondrial genes, the nature of MNGIE is an inherited metabolic disorder caused by a deficiency of the cytoplasmic enzyme TP. Previous research on TP suggests that TP has several functions, including promoting angiogenesis, regulating cell growth and proliferation, inhibiting apoptosis, regulating platelet activation and controlling adipocyte differentiation. However, the mechanisms of action of TP are not yet fully understood [
3‐
11]. Therefore, in addition to influencing mtDNA replication, TP may also be involved in other cellular activities to exert its effect. Therefore, the pathological mechanisms underlying the clinical phenotype of MNGIE due to TP deficiency are incompletely understood. In particular, the effects of intracellular nucleoside accumulation and TP protein deficiency on other organelles such as the endoplasmic reticulum, lysosomes and cytoskeleton are still unclear.
As a cellular “recycling center” and hub for metabolic signals, lysosomes are closely involved in mitochondrial quality control. On the one hand, lysosomes play a crucial role in mitochondrial clearance, including various pathways such as PINK1-parkin-, BNIP3- or FUNDC1-mediated mitophagy, mitochondria-derived vesicles, migrasome-mediated mitochondrial ejection and lysosome-associated exocytosis [
12‐
20]. On the other hand, mitochondria and lysosomes can form dynamic membrane contact sites or connections for direct communication through proteins such as Rab7, TBC1D15, Fis1 and GDAP1 [
21‐
24]. This interaction between mitochondria and lysosomes plays a crucial role in regulating the dynamics, function and metabolite transport of organelle networks [
25‐
28]. Thus, there is a close structural and functional link between lysosomes and mitochondria, but the status of lysosomal function in MNGIE remains unclear.
TP is a key enzyme in nucleotide metabolism, while lysosomes play an important role in the degradation and recycling of nucleic acids. On the one hand, nucleic acids can be delivered to lysosomes as part of larger structures by mitochondrial autophagy, ribosomal autophagy, nuclear budding, piecemeal microautophagy of the nucleus, RNA granule autophagy, etc [
29‐
34]. . On the other hand, RNA and DNA can be directly transported to lysosomes for degradation by receptors such as LAMP2C and SIDT2 in an ATP-dependent manner, a process known as RNA autophagy/DNA autophagy [
35,
36]. Once various forms of nucleic acid molecules enter the lysosomal lumen as autophagic substrates, they are degraded into mononucleotides or oligonucleotides by acid hydrolases such as RNase T2 and DNase II [
37]. The nucleotides are further hydrolyzed to nucleosides. Nucleosides, the end products of nucleic acid degradation in lysosomes, are transported back into the cytoplasm via lysosomal nucleoside transport proteins such as SLC29A3/ENT3. They are then degraded to the corresponding bases or enter the recycling pathways [
38,
39].
Overall, lysosomes are important cellular organelles involved in the regulation of mitochondrial homeostasis and nucleotide metabolism. Elucidating the effects of TP defects on lysosomal function is crucial for further understanding the pathophysiological mechanisms of MNGIE. In this study, we identified a lysosomal dysfunction caused by TYMP deficiency that is associated with the accumulation of nucleosides in lysosomes.
Materials and methods
Participants and sample collection
The MNGIE and MELAS patients are the same patients reported in our previous study, with matching clinical information and sample names [
40]. The muscle biopsies and punch biopsies of the skin were performed according to standard procedures. Patient MNGIE-2 declined the muscle biopsy, and the muscle biopsy of patient MNGIE-3 was completed by another hospital in his adolescence with a few remaining muscle samples.
For the skin biopsies in the HC group, the individuals and collection procedure were the same as in our previous study [
40]. The muscle biopsies in the HC group were sex- and age-matched healthy control samples (no abnormalities were detected in the muscle biopsy).
Cell culture, plasmids and cell line constructs
Fibroblasts were obtained from skin biopsies. 293T cells were purchased from the American Type Culture Collection (ATCC, CRL-3216). Cells were cultured in Dulbecco’s modified Eagle medium (DMEM; CM10013, MACGENE) supplemented with 10% fetal bovine serum (16,140,071, Gibco) and penicillin/streptomycin (P1400, Solarbio) at 37 ℃/5% CO2. Fibroblasts were grown to 80 to 90% confluence before harvesting and passaging, with no more than 20 passages. All cell lines tested negative for mycoplasma contamination.
For the knockout of TYMP, the pLentiCRISPR-sgTYMP plasmid was constructed using the vector pLentiCRISPRv2 and the sgRNA sequence published in a previous study (sense 5′ CAGAGATGTGACAGCCACCG 3′; antisense 5′ CGGTGGCTGTCACATCTCTG 3′). pLentiCRISPR-sgTYMP and the control plasmids were transfected onto 293T cells using Lipofectamine 2000 reagents (Invitrogen). After 24 h of transfection, cells were seeded at a density of 1 cell/well in 96-well plates and then single cell colonies were grown. The cell clones of TYMP-knocked out were validated by analyzing TP protein expression by Western blot.
For the overexpression of TMEM192-3×HA, the sequence of TMEM192-3×HA from pLJC5-TMEM192-3xHA (Addgene plasmid # 102,930) was incorporated into the pLVX-Puro vector. The pLVX-TMEM192-3xHA-Puro plasmid was cotransfected with psPAX2 and phCMV-VSV-G packaging vectors to obtain a lentivirus encoding TMEM192-3xHA. 293T cells were transduced with the TMEM192-3×HA lentivirus, selected with puromycin, and single cell clones were isolated to generate the stable TMEM192-3×HA expressing 293T cell line. Based on the stable TMEM192-3×HA expressing cells obtained, TYMP knockout was performed according to the procedure described above.
For the mCherry-EGFP-LC3 reporter, the sequence of mCherry-EGFP-LC3B was obtained from the pBabe-puro mCherry-EGFP-LC3B (Addgene plasmid #22,418) and cloned into the vector pLenti-CMV-IRES-Puro-WPRE. For lentiviral packaging, mCherry-EGFP-LC3B was co-transfected into 293T cells together with psPAX2 and phCMV-VSV-G packaging vectors using Lipofectamine 2000. Stable mCherry-EGFP-LC3 expressing 293T cells were generated by lentiviral transduction and selection in growth media containing 1 µg/mL puromycin.
Western blot
The procedures for Western blotting have been described in our previous publications. In brief, the lysis buffer used for protein isolation of cells and tissues was radioimmunoprecipitation assay buffer (R0020, Solarbio) supplemented with protease inhibitors (HY-K0010, MCE) and phosphatase inhibitors (P1260, Solarbio). To increase the efficiency of lysis, the frozen muscle tissue were cut into 8 mm cross-sections using a cryostat, manually pulverized in liquid nitrogen and then mixed with the lysis buffer. A total of 10–20 µg of proteins were loaded onto 8–12% SDS-PAGE. After blocking with 5% milk at room temperature for 1 h, the membranes were incubated overnight with the primary antibody at 4 °C. The membranes were then washed with Tris-buffered saline with Tween 20 (TBST) buffer and incubated with horseradish peroxidase-linked antibody at room temperature for 1 h, followed by another round of TBST washes. Protein bands were detected using the Tanon 4600 SF chemiluminescence imaging system and grayscale values of the bands were calculated using ImageJ software. Supplementary Table
1 contains a list of the antibodies used. Uncropped original Western blots were uploaded in Supplementary file 9.
Quantitative reverse transcription PCR and mtDNA copy number analysis
Total RNA was extracted from tissues and cells using TRIzol (15,596,026, Invitrogen). Prior to mixing with TRIzol, frozen muscle biopsy tissue were sectioned to 8 mm cross-section using a cryostat and manually pulverized in liquid nitrogen. Complementary DNA was synthesized from 1 µg of RNA with HiScript II Q RT SuperMix (R223-01, Vazyme). SYBR Green Master Mix (Q711-02, Vazyme) was used to perform quantitative PCR (qPCR) in the QuantStudio 3 Real-Time PCR System. The relative quantification of mRNA expression was normalized to the reference gene ACTB.
Genomic DNA from muscle tissues and cells were isolated with the TIANamp Genomic DNA Kit (TIANGEN, DP304). Relative mtDNA copy numbers were analyzed by qPCR of mtDNA genes (ND1, ND5) and nuclear DNA (nDNA) genes (SLCO2B1, SERPINA1). Briefly, the ratios of ΔCt(Ct [ND1]- Ct [SLCO2B1]) or ΔCt(Ct [ND5]-Ct [SERPINA1]) values in the experimental and control groups were calculated as relative mtDNA copy number. The primer sequences are listed in Supplementary Table
2.
Assay of lysosomal activity
The lysosomal activities of cathepsin B and cathepsin D were determined using Magic Red Cathepsin B (#937, ImmunoChemistry Technologies) and BODIPY FL-Pepstatin A (P12271, Invitrogen), respectively. Fibroblasts were seeded in 96-well plates (black, clear bottom, PerkinElmer) at a density of 5000 cells/well and grown until the cells reached a confluence of 40%. Magic Red Cathepsin B and BODIPY FL-Pepstatin A stock solutions were prepared according to the manufacturer’s instructions. Cells were incubated with Magic Red Cathepsin B (1:25 dilution, 30 min) or BODIPY FL-Pepstatin A (1 µM, 1 h) in the dark at 37℃. Total lysosomal hydrolytic or degradation activity was determined with fluorescein isothiocyanate (FITC)-conjugated 40 K MW dextran (Xian Qiyue Biology, China). Cells were loaded with FITC-dextran (0.5 mg/mL) for 4 h at 37 °C. They were then washed with PBS and chased in fresh culture medium for 20 h to allow the dextran to be transported into the lysosomes or late endosomes. After washing twice with PBS, the cells were incubated for 10 min with Hoechst 33,342 (Immunochemistry Technologies) at a concentration of 1 µg/mL and then washed with PBS prior to imaging. Fibroblasts were imaged using the Opera Phenix High-Content Screening System (PerkinElmer) at 40×objective. Images were analyzed using ImageJ software. The 293T cells loaded with FITC-dextran can also be analyzed by CytoFLEX flow cytometry (Beckman Coulter, USA) without Hoechst 33,342 staining. Quantitative analysis of fluorescence intensities was calculated with FlowJo v10.8.1 software.
LysoTracker Red (LTR), LysoSensor Green (LSG) and Acridine Orange (AO) staining
Fibroblasts and 293T cells were cultured in 6-well plates and grew to 80% confluence at the end of the experiment. After pharmacological manipulations or resting cultures, the culture medium was removed and adherent cells were detached with 0.25% trypsin-EDTA (CC017, MACGENE) and collected separately in microcentrifuge tubes, followed by centrifugation (300×g, 4 min). Then the cells were resuspended and incubated with fresh medium containing LTR (50 nM, 40739ES50, YEASEN Biology) or LSG (1 µM, 40767ES50, YEASEN Biology) at 37℃ in the dark, mixing gently every 15 min. After washing twice with PBS, the cells were resuspended with PBS and analyzed by flow cytometry using the CytoFLEX flow cytometer (Beckman Coulter, USA). Quantitative analysis of fluorescence intensities was calculated with FlowJo v10.8.1 software.
For AO staining, fibroblasts were seeded at a density of 5000 cells/well in 96-well plates (black, clear bottom, PerkinElmer) and grown to 40% confluence. The culture medium was replaced with fresh medium containing AO (1 µM, Immunochemistry Technologies) and incubated for 30 min at 37℃ in the dark and then washed with PBS. Cells were analyzed using the Opera Phenix High-Content Screening System (PerkinElmer) and ImageJ software. The excitation filter used was 488 nm and the emission filter was 500–530 nm.
Lysosomal immunoprecipitation (Lyso-IP) proteomics and nucleoside analysis
Lysosomes from cells expressing TMEM192-3xHA were purified according to previously published reports [
41]. In brief, cells were seeded in 15 cm dishes at a density suitable to achieve 90% confluence for each sample. Cells were washed twice with ice-cold PBS, scraped in 950 µL ice-cold KPBS buffer (136 mM KCl, 10mM KH2PO4, pH 7.25) and pelleted at 4℃ (2 min, 1000×g). Subsequent steps were performed on ice. The pelleted cells were resuspended in 950 µL of cold KPBS. 25 µL of the resuspended sample was taken for whole cell protein assay and immediately mixed with RIPA lysis buffer containing protease inhibitors. Protein quantification was performed for the whole-cell protein samples to normalize cell numbers for subsequent data analysis. The remaining cells were carefully homogenized with 20 strokes in a tight-fitting Dounce homogenizer. The homogenate was then centrifuged at 1000×g for 2 min at 4 °C to remove nuclei and debris. The supernatant was mixed with 100 µL KPBS prewashed anti-HA magnetic beads and incubated on a rotator at 4℃. For proteomics analysis, the beads were gently shaken with the lysate for 20 min at 6 rpm. For nucleoside or biochemical detection, the beads were shaken at maximum speed (90 rpm) for 3 min. The immunoprecipitates were then gently washed three times with KPBS using a DynaMag Spin Magnet and then eluted in 100 µL KPBS containing 0.5% NP40 (30 min, 4℃) for proteomic analysis or mixed with 50 µL -80℃ frozen methanol: water (80:20, v/v) for subsequent nucleoside analysis. Three biological replicates per group (sgNC vs. sgTYMP) were taken.
Quantitative proteomic analysis was performed by Wuhan GeneCreate Biological Engineering Co., Ltd. A total of 317 proteins or protein fragments were identified. For data quality control, the proteins with 2 missing values in each group were removed, and the remaining missing values were imputed as 1. 260 proteins were then identified for further statistical analysis. Significant differential proteins were defined as proteins with p < 0.05 (two-tailed unpaired Welch’s t-test) and log2FC > 0.5 or <-0.5. Volcano plots were calculated using a combination of FC and p-value. Gene Ontology (GO) enrichment analysis, which included cell components (CC) for the downregulated and upregulated proteins, was performed using the clusterProfiler R package.
Nucleoside analysis was performed by Lipidall Technologies Co. Ltd. using ultra-performance liquid chromatography (UPLC) coupled to a quadrupole time-of-flight (Q-TOF) mass spectrometry instrument. Differential analysis of nucleoside metabolites was calculated using semi-quantitative values of the areas under the curve.
Flow cytometric analysis of JC-1 and MitoSOX staining
Cells were seeded in 6-well plates at a density suitable to achieve 80–90% confluence on the day of collection after treatment with the preparations. After collection by trypsinization, the collected pellets were washed with PBS. According to the manufacturer’s instructions of JC-1 (M8650, Solarbio) or MitoSOX (M36008, Invitrogen), the cells were stained with the prepared JC-1 solution (diluted 1:200 in JC-1 buffer) or MitoSOX solution (diluted 6 µM in medium) and incubated for 20–30 min in the dark at 37℃. During incubation, the cells were gently mixed every 10 min. For JC-1 staining, 5 µM carbonyl cyanide-3-chlorophenylhydrazone (CCCP) was added as a positive control during incubation. Cells were washed, resuspended in PBS and analyzed by CytoFLEX flow cytometry (Beckman Coulter, USA). Quantification was performed using FlowJo v10.8.1 software.
Cell viability assay
The Cell Titer-Glo Luminescent Cell Viability Assay (Promega) was used for the ATP assay as previously described. In brief, 293T cells (104 per well) were seeded into the black 96-well plates in five replicates. The Cell Titer Glo assay reagent was obtained by mixing the assay buffer and substrate, both of which were brought to room temperature. After 48 h of pharmacological manipulations, 100 µl of the prepared assay reagent was added to each well and mixed by shaking for 2 min. After incubation for 10 min at room temperature, the bioluminescence was read on a Synergy H1 plate reader (BioTek). The amount of ATP present is directly proportional to the intensity of luminescence.
Flow cytometric analysis of autophagic flux
293T cells expressing mCherry-EGFP-LC3 were seeded in 6-well plates and treated with compounds. After the cells were harvested with trypsin and washed with PBS, they were analyzed by CytoFLEX flow cytometry, recording 10,000 events per experiment. To establish flow cytometry gates, cells treated with 100 µM bafilomycin A1 for 24 h were used as a control for fully inhibited autophagic flux. Starting from the bafilomycin-treated cells, approximately 5% of the cells in the rectangular “autophagy” gate were positive. The changes in autophagy flux were determined as a shift in the cell ratio in this gate after the experimental stimulus. The data were analyzed using FlowJo v10.8.1 software.
Statistical analysis
Statistical analysis was performed using GraphPad Prism 9, and the Shapiro‒Wilk test was performed to assess the normal distribution. All data were collected and analyzed using a double-blinded approach. Detailed statistical information on the experiments, including the number of replicates (n) and the statistical tests used, are included in the figure legends. Significance levels are indicated as *p < 0.05, **p < 0.01, ***p < 0.001.
Discussion
Lysosomes play a crucial role in mitochondrial quality control as the destination of mitochondrial clearance and are closely associated with mitochondrial function [
21,
49,
50]. In this study, we used various methods such as tissue extraction, primary cell culture, gene knockout, and chemical inhibition to reveal lysosomal dysfunction in MNGIE disease or TP deficiency. In addition, we isolated and analyzed lysosomes from
TYMP-deficient cells using Lyso-IP and proteomic techniques, investigated changes in lysosomal proteins, and confirmed the accumulation of nucleosides in lysosomes. In addition, we validated changes in lysosomal dysfunction and mitochondrial homeostasis caused by excessive accumulation of thymidine and deoxyuridine in cells.
Compared to previously discovered lysosomal damage caused by mitochondrial dysfunction, this study showed a distinctive form of lysosomal dysfunction in MNGIE. Previous studies have shown that knockout or knockdown of certain mitochondrial proteins such as AIF, OPA1, PINK1 and UQCRC1 not only leads to mitochondrial dysfunction, but also impairs lysosomes, resulting in enlarged lysosomes, the appearance of large vacuoles and impaired lysosomal enzymatic activity. However, the protein content of LAMP1 remained normal [
51,
52]. This is consistent with our findings of increased LAMP1 expression in muscle samples from m.3243 A > G MELAS patients. In addition, knockout of the p32 gene leading to mitochondrial translation defects was found to result in an increased number of lipofuscin-containing lysosomes in mouse hearts, indicating impaired lysosomal and autophagic functions [
53]. In addition, a recent study discovered an increased number of lysosomes and altered spatial localization in ragged red fibers (RRF) of a mitochondrial myopathy mouse model, suggesting abnormal lysosomal homeostasis in RRF [
54]. Since muscle samples from m.3243 A > G MELAS patients contain a large amount of RRF, the increased level of LAMP1 observed in the muscles of MELAS patients may be related to the increased number of lysosomes in RRF. Finally, an acute increase in ROS concentration may also cause permeabilization of lysosomal membranes and a decrease in LAMP1 protein levels, leading to cell death [
55‐
57]. Collectively, lysosomal damage caused by mitochondrial dysfunction or ROS-induced damage can be categorized into two situations: lysosomal enlargement and increased lysosomal quantity due to long-term mitochondrial defects or lysosomal membrane permeabilization and cell death due to acute ROS production. However, in MNGIE patients or TP-deficient cells, lysosomes do not show increased volume despite long-term abnormalities of mitochondrial proteins, but rather reduced or dysregulated expression of lysosomal membrane proteins. This abnormality of the lysosomal membrane differs from the permeabilization of the lysosomal membrane and does not lead to a significant tendency to cell death. We therefore conclude that TP deficiency leads to lysosomal dysfunction characterized by membrane dysregulation without marked cell death.
TP is a key enzyme in nucleoside metabolism, and its defects can lead to the accumulation of large amounts of thymidine and deoxyuridine in cells, which is also the underlying cause of the mitochondrial dysfunction observed in MNGIE [
2]. Nucleosides are the end products of lysosomal degradation of various forms of nucleic acids in cells and are recycled to the cytoplasm via carrier proteins by facilitated diffusion along concentration gradients [
38,
39,
58,
59]. Previous studies have revealed that the ENT3 protein in mammalian cells is a lysosome-localized nucleoside transporter with pH-dependent transport activity that is responsible for the transport of various nucleosides such as adenosine, uridine and cytidine from the lysosomal lumen into the cytoplasm [
39,
60]. Therefore, we speculate that the long-term accumulation of thymidine and deoxyuridine in the cytoplasm of
TYMP-deficient cells may hinder lysosomal nucleoside recycling, leading to increased nucleoside accumulation in the lysosomal lumen. In addition, nucleosides have weak alkaline properties and can bind hydrogen protons, thereby alkalizing lysosomes. Disruption of the acidic environment of lysosomes reduces lysosomal enzyme activity, impairs normal substrate hydrolysis and leads to a range of lysosomal dysfunctions. Consistent with our hypothesis, we found increased levels of various nucleosides such as cytidine nucleoside, uridine, guanosine nucleoside, adenosine and cytidine in lysosomes extracted from
TYMP-deficient cells, as well as increased levels of mitochondrial proteins and decreased levels of lysosomal membrane V-ATPase proteins in lysosomal protein extracts from
TYMP-deficient cells. Similar to mitochondrial dysfunction caused by mitochondrial overload with dThd and dUrd in MNGIE, these results suggest that the accumulation of lysosomal nucleosides is the cause of the imbalance of lysosomal membrane proteins, disruption of the acidic environment, and impairment of degradation capacity. In addition, many antiretroviral drugs such as zidovudine, didanosine and stavudine, which are nucleoside analogs, have also been found to inhibit autophagy, disrupt the acidic environment in the lysosomes, increase mitochondrial mass and increase the production of reactive oxygen species [
61‐
63]. These nucleoside analogs can also be transported by ENT3, which is consistent with our results and suggests a possible mechanism of inhibition of lysosomal nucleoside recycling by nucleoside analogs [
64]. Interestingly, Stankov et al. found that the cytidine analogs zidovudine and stavudine can inhibit adipocyte proliferation and lipid synthesis, which is consistent with the inhibition of fatty acid synthesis metabolism in
TYMP deficiency observed in our previous study and further highlights the importance of TP protein in cell metabolism homeostasis and organelle function [
40,
61,
62].
Our results suggested that in the context of MNGIE, mitochondrial and lysosomal damage coexist and reinforce each other: on the one hand, defects in mitochondrial energy metabolism increase the generation of ROS, which may in turn increase the permeability of lysosomal membranes; on the other hand, lysosomal dysfunction impedes the normal clearance of mitochondria, leading to the persistent presence of abnormal mitochondria with mtDNA defects. Similarly, defects in the ENT3 protein have been found to simultaneously lead to mitochondrial damage and lysosomal dysfunction, resulting in an accumulation of mitochondrial redundancy, increased ROS and increased lysosomal volume [
65,
66]. The mechanism behind this phenomenon may be consistent with the mechanism of mitochondrial and lysosomal nucleoside accumulation caused by TP deficiency, as studies have shown that ENT3 is localized not only in lysosomes but also in mitochondria [
60]. Interestingly, two key amino acids responsible for pH sensing, glutamic acid at position 447 and aspartic acid at position 219, have opposite orientations in lysosomes and mitochondria. ENT3 localized in lysosomes transports nucleosides from lysosomes into the cytoplasm, whereas ENT3 localized in mitochondria is responsible for the transport of nucleosides from the mitochondrial intermembrane space into the mitochondrial matrix. Therefore, ENT3 defects not only lead to lysosomal nucleoside accumulation, but also impair nucleoside availability in the mitochondria. Based on this feature of ENT3, we propose a pathogenic model for MNGIE: cytoplasmic accumulation of thymidine and deoxyuridine caused by TP deficiency enters mitochondria on the one hand, leading to imbalance of mitochondrial nucleoside levels and disruption of mtDNA homeostasis, and on the other hand, it causes excessive accumulation of nucleosides in lysosomes, resulting in lysosomal dysfunction.
Although our study provides theoretical insights, it is important to recognize its limitations. Due to the complex interplay between mitochondria and lysosomes, we compared the phenotypes of tissues and cells from MNGIE patients with those from m.3243 A > G MELAS patients to clarify the direct effects of TP deficiency on lysosomal dysfunction and exclude the involvement of mitochondrial damage. However, this approach cannot completely exclude the possibility that mitochondrial damage due to mtDNA defects contributes to lysosomal dysfunction in the TP deficiency model. Nonetheless, the lysosomal damage observed in TP-deficient cells differs from the features resulting from mitochondrial dysfunction observed in previous studies, suggesting in part a direct influence of TP deficiency on lysosomal damage. Future studies should investigate the effects of TP deficiency on lysosomal function by fully correcting mtDNA defects in TP-deficient cells using techniques such as mtDNA replacement. Besides, while the 293T cell model allowed us to investigate certain aspects of TP deficiency and lysosomal malfunction, it may not fully recapitulate the mitochondria accumulation seen in MNGIE muscles. A more comprehensive evaluation of the disturbed mitochondrial and lysosomal homeostasis using in vivo models or organoids derived from patients is worthy in the future.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.