Skip to main content
Erschienen in: BMC Oral Health 1/2022

Open Access 01.12.2022 | Research

Effect of Enterococcus faecalis OG1RF on human calvarial osteoblast apoptosis

verfasst von: Yang Li, Shuyu Sun, Cheng Wen, Jialin Zhong, Qianzhou Jiang

Erschienen in: BMC Oral Health | Ausgabe 1/2022

Abstract

Background

Enterococcus faecalis is a dominant pathogen in the root canals of teeth with persistent apical periodontitis (PAP), and osteoblast apoptosis contributes to imbalanced bone remodelling in PAP. Here, we investigated the effect of E. faecalis OG1RF on apoptosis in primary human calvarial osteoblasts. Specifically, the expression of apoptosis-related genes and the role of anti-apoptotic and pro-apoptotic members of the BCL-2 family were examined.

Methods

Primary human calvarial osteoblasts were incubated with E. faecalis OG1RF at multiplicities of infection corresponding to infection time points. Flow cytometry, terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay, caspase-3/-8/-9 activity assay, polymerase chain reaction (PCR) array, and quantitative real-time PCR were used to assess osteoblast apoptosis.

Results

E. faecalis infection increased the number of early- and late-phase apoptotic cells and TUNEL-positive cells, decreased the mitochondrial membrane potential (ΔΨm), and activated the caspase-3/-8/-9 pathway. Moreover, of all 84 apoptosis-related genes in the PCR array, the expression of 16 genes was upregulated and that of four genes was downregulated in the infected osteoblasts. Notably, the mRNA expression of anti-apoptotic BCL2 was downregulated, whereas that of the pro-apoptotic BCL2L11, HRK, BIK, BMF, NOXA, and BECN1 and anti-apoptotic BCL2A1 was upregulated.

Conclusions

E. faecalis OG1RF infection triggered apoptosis in human calvarial osteoblasts, and BCL-2 family members acted as regulators of osteoblast apoptosis. Therefore, BCL-2 family members may act as potential therapeutic targets for persistent apical periodontitis.
Hinweise
Yang Li and Shuyu Sun contributed equally to this work.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
APAF1
Apoptotic peptidase activating factor 1
BAX
Apoptosis regulator BAX
BCL-2
B-cell lymphoma-2
BCL2A1
BCL2-related protein A1
BCL2A1
BCL-2-related protein A1
BCL2L11
BCL2-like 11
BCL2L12
BCL-2-like protein 12
BECN1
Beclin-1
BIK
BCL2-interacting killer
BMF
BCL-2-modifying factor
BOK
BCL-2-related ovarian killer protein
HRK
Harakiri, BCL2-interacting protein
MOI
Multiplicity of infection
MOMP
Mitochondrial outer membrane permeabilization
MULE
E3 ubiquitin-protein ligase HUWE1
NOXA
Phorbol-12-myristate-13-acetate-induced protein 1
PCR
Polymerase chain reaction
PI
Propidium iodide
PUMA
BCL-2-binding component 3, isoforms 1/2
qRT-PCR
Quantitative real-time PCR
TNF
Tumour necrosis factor
TNFRSF
Tumour necrosis factor receptor superfamily
TUNEL
Terminal deoxynucleotidyl transferase dUTP nick end labelling
ΔΨm
Mitochondrial membrane potential

Background

Persistent apical periodontitis (PAP) is an endodontic inflammatory condition characterised by bone destruction in the periapical region [1]. Inflammatory bone destruction is generally associated with an imbalance between bone degradation and formation [2]. In addition to enhanced osteoclastogenesis and subsequential bone resorption, increased osteoblast apoptosis decreases the synthesis of bone matrix and deposition of new bone, resulting in bone loss in inflammatory bone diseases [3]. Bacteria and their by-products are considered responsible for osteoblast apoptosis in osteomyelitis, periodontitis, and PAP [46]. Evidence has highlighted that Enterococcus faecalis is one of the causative microorganisms of PAP [7, 8]. The detection of E. faecalis in infected root canals has been associated with the occurrence of periapical lesions larger than 3 mm, indicating the role of E. faecalis in PAP and endodontic treatment failure [9]. Recent studies have found that E. faecalis induces apoptosis in mouse osteoblast-like MC3T3 cells and human osteosarcoma MG63 cells [1012]. However, there may be a difference between the effect of E. faecalis infection in primary osteoblasts and osteoblast-like cells from different origins [10, 13]. The apoptosis-inducing effect of E. faecalis and its mechanisms in human primary osteoblasts remain elusive.
Bacteria may induce apoptosis in osteoblasts via intrinsic (caspase-9 dependent) and/or extrinsic (caspase-8 dependent) pathway(s) through the activation of executioner caspase-3 [5, 11]. Apoptosis-related genes, such as tumour necrosis factor receptor superfamily (TNFRSF) and caspase activity inhibitors (e.g., BIRC6, NAIP, and XIAP), may also play important roles in infection-induced apoptosis [14]. Notably, the B-cell lymphoma-2 (BCL-2) family plays a key role in the intrinsic apoptotic pathway [15]. The sophisticated modulation of the balance between anti-apoptotic and pro-apoptotic members of the BCL-2 family can determine cell fate decisions of life or death, giving rise to numerous diseases, such as cancer and autoimmune diseases [16, 17]. Studies have reported that anti-apoptotic BCL-2 and BCL2L1 (also known as BCLXL), and pro-apoptotic BID, BIM, and BAX may play roles in the pathogenesis of periodontitis [5, 18, 19]. BCL-2, BCL2L1, BAD, and BAX may also be involved in the molecular mechanisms linking periodontal disease with cancer [20]. However, the putative role of the BCL-2 family and other apoptosis-related genes in E. faecalis-infected primary osteoblasts remains inconclusive.
Here, we investigated the apoptotic effect of E. faecalis OG1RF on primary human calvarial osteoblasts. The strain OG1RF is a rifampicin- and fusidic acid-resistant derivative of a caries-related strain OG1 isolated in 1975 [21, 22]. Because of its oral rather than urinary origin (e.g., ATCC 29,212), it is commonly used to investigate the pathogenicity of E. faecalis in apical periodontitis [23, 24]. We examined the mRNA expression of 84 apoptosis-related genes, and explored the role of anti-apoptotic and pro-apoptotic members of the BCL-2 family in E. faecalis-induced osteoblast apoptosis.

Methods

Cultures of osteoblasts and E. faecalis OG1RF

Primary human calvarial osteoblasts were obtained from ScienCell Research Laboratories (#4600; Carlsbad, CA, USA) and cultivated in a medium (#4601) containing 1% osteoblast growth supplement (#4652), 1% penicillin/streptomycin solution (#0503), and 5% foetal bovine serum (#0025) at 37 °C in a humidified atmosphere with 5% CO2. In this study, cells from passages 3 to 6 were used. E. faecalis OG1RF, obtained from ATCC (Manassas, VA, USA), was cultured in brain–heart infusion broth (Difco Laboratories, Detroit, MI, USA) under aerobic conditions at 37 °C to the mid-logarithmic phase [22].
To examine the effect of E. faecalis OG1RF on osteoblast apoptosis, the cells were plated onto 24-well plates at 1.5 × 105/well or six-well plates at 6 × 105/well. At the indicated infection time points, E. faecalis OG1RF at the corresponding multiplicity of infection (MOI) was added to the osteoblast culture, as previously described [12].

Flow cytometry

To evaluate the apoptotic rate of cells (in early and late phases), primary osteoblasts were incubated with E. faecalis OG1RF at MOIs of 10, 100, 500, and 1,000 for 6 and 12 h, respectively. The infected cells were incubated with staining solution containing propidium iodide (PI) and FITC Annexin V (#556,570; BD Biosciences, San Diego, CA, USA) at 25 °C for 15 min. The apoptotic cells in early (FITC Annexin V+/PI) and late (FITC Annexin V+/PI+) phases were analysed using a FACSCalibur flow cytometer (BD Biosciences, San Diego, CA, USA).
To detect the change in mitochondrial membrane potential (ΔΨm), primary osteoblasts were incubated with E. faecalis OG1RF at MOIs of 10, 100, 500, and 1,000 for 6 and 12 h, respectively. The infected cells were incubated with 0.5 mL of JC-1 staining solution (#C2006; Beyotime, Shanghai, China) and evaluated using a FACSCalibur flow cytometer. The ΔΨm was estimated by calculating the ratio of red/green fluorescence intensities as previously reported [12].

Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay

To examine DNA damage in apoptotic cells, primary osteoblasts were infected with E. faecalis OG1RF at an MOI of 1,000 for 12 h. After fixation and permeabilization, the infected cells were treated with a reaction mixture containing the label and enzyme solutions (#11,684,817,910; Roche, Penzberg, Bayern, Germany) at 37 °C for 60 min to detect TUNEL-positive cells in randomly selected microscopic fields. A 50-µL label solution without TUNEL enzyme was used as the negative control to detect nonspecific labelling.

Caspase-3/-8/-9 activity assay

To detect the activity of caspase-3/-8/-9, primary osteoblasts were infected with E. faecalis OG1RF at an MOI of 1,000 for 12 h. The infected cells were evaluated using caspase-3 (#C1116)/-8 (#C1152)/-9 (#C1158) activity assay kits (Beyotime) according to the manufacturer’s instructions. After the cell lysates were harvested and incubated with protease substrates at 37 °C for 6 h, the optical densities (405 nm) of the lysates were evaluated using a microplate reader (Tecan, Reading, UK).

Human polymerase chain reaction (PCR) array

To explore the mRNA expression profile of apoptosis-related genes in apoptotic osteoblasts, primary osteoblasts were incubated with E. faecalis OG1RF at an MOI of 1,000 for 12 h. The Human Apoptosis RT Profile PCR Array (#PAHS-012Z; SABiosciences, Valencia, CA, USA) was employed to simultaneously evaluate the expression of 84 apoptosis-related genes in E. faecalis-infected osteoblasts according to the manufacturer’s instructions. A P-value < 0.05 with a fold change > 2 (following normalisation to housekeeping genes) was regarded as a significant upregulation or downregulation in mRNA expression.

Quantitative real-time PCR (qRT-PCR)

To validate the results of the PCR array and further evaluate the expression of BCL-2 family members, primary osteoblasts were infected with E. faecalis OG1RF at an MOI of 1,000 for 12 h. Total RNA was extracted using TRIzol reagent (#15,596,018; Invitrogen, Carlsbad, CA, USA) and quantified using Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA), followed by cDNA synthesis using a reverse transcription kit (#RR036A; Takara, Kyoto, Japan). qRT-PCR was performed under universal cycling conditions using SYBR Premix Ex TaqII (#RR820A; Takara, Kyoto, Japan) in a CFX96 Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA). The 2−ΔΔCt method was used to determine the expression of the following genes: BCL2, BCL2L11 (also known as BIM), HRK, BIK, BCL2A1 (also known as BFL1), CASP10, BMF, PMAIP1 (also known as NOXA), BECN1, BAD, BAX, HUWE1 (also known as MULE), BCL2L12, BBC3 (also known as PUMA), and BOK. Primer sequences are listed in Table 1.
Table 1
Primers for qRT-PCR
Gene
GenBank accession number
Forward primer (5′ → 3′)
Reverse primer (5′ → 3′)
BCL2
NM_000633
CGCCCTGTGGATGACTGAGTA
GGGCCGTACAGTTCCACAAAG
BCL2L11
NM_006538
TAAGTTCTGAGTGTGACCGAGA
GCTCTGTCTGTAGGGAGGTAGG
HRK
NM_003806
GCAACAGGTTGGTGAAAACCCT
ATTGGGGTGTCTGTTTCTGCAGC
BIK
NM_001197
GACCTGGACCCTATGGAGGAC
CCTCAGTCTGGTCGTAGATGA
BCL2A1
NM_004049
TCCAAAAAGAAGTGGAAAAGAATC
GCTGTCGTAGAAGTTTCTTGATGA
CASP10
NM_001230
TAGGATTGGTCCCCAACAAGA
GAGAAACCCTTTGTCGGGTGG
BMF
AY222040
GAGCCATCTCAGTGTGTGGAG
GCCAGCATTGCCATAAAAGAGTC
NOXA
BC032663
ACCAAGCCGGATTTGCGATT
ACTTGCACTTGTTCCTCGTGG
BECN1
NM_003766
CCATGCAGGTGAGCTTCGT
GAATCTGCGAGAGACACCATC
BAD
NM_004322
CGGAGGATGAGTGACGAGTT
GATGTGGAGCGAAGGTCACT
BAX
NM_004324
CCCTTTTGCTTCAGGGTTTCATCCA
CTTGAGACACTCGCTCAGCTTCTTG
MULE
NM_031407
TTGGACCGCTTCGATGGAATA
TGAAGTTCAACACAGCCAAGAG
BCL2L12
NM_138639
GAGACCGCAAGTTGAGTGGAG
GAAGGCAGCTAGGACCCTC
PUMA
AF354656
GCCAGATTTGTGAGACAAGAGG
CAGGCACCTAATTGGGCTC
BOK
AF089746
GTCTTCGCTGCGGAGATCAT
CATTCCGATATACGCTGGGAC
qRT-PCR was performed under universal cycling conditions

Statistical analysis

All experiments were conducted in triplicate. Statistical analysis was performed using one-way analysis of variance followed by Tukey’s post hoc test using SPSS 21.0. A P value of < 0.05 was considered statistically significant.

Results

E. faecalis infection triggered early and late apoptosis in primary osteoblasts

To detect apoptosis (both in early and late phases) in osteoblasts infected with E. faecalis OG1RF, we conducted flow cytometry analysis using Annexin V-FITC/PI staining (Fig. 1a). Figure 1b shows the percentage of apoptotic cells in osteoblasts infected with E. faecalis OG1RF for 6 and 12 h. At 6 h, the peak of early apoptosis was observed at an MOI of 500 (P < 0.05), whereas at 12 h, it was observed at an MOI of 100 (P < 0.01). At 6 h, the percentage of apoptotic cells in the late phase was increased at MOIs of 500 and 1,000 compared with that in the control group (P < 0.01), whereas at 12 h, the increase showed an MOI-dependent trend (P < 0.05). Furthermore, there were more late apoptotic cells at a higher MOI (MOIs of 500 and 1,000), regardless of the infection time (6 or 12 h), and more early apoptotic cells were observed at a lower MOI (10 and 100) at 12 h (P < 0.05).

E. faecalis infection caused DNA fragmentation in primary osteoblasts

To examine the DNA damage in osteoblasts infected with E. faecalis OG1RF, we conducted TUNEL staining. TUNEL-positive cells were detected in osteoblasts following infection with an MOI of 1,000 for 12 h (Fig. 2). We observed few TUNEL-positive cells in both the negative and blank controls.

E. faecalis infection decreased ΔΨm in primary osteoblasts

To detect ΔΨm in osteoblasts infected with E. faecalis OG1RF, we conducted flow cytometry analysis using JC-1 staining (Fig. 3a). We found a significant decrease in the ratio of red/green fluorescence intensities in osteoblasts following infection with MOIs of 500 and 1,000 for 6 h and MOIs of 100, 500, and 1,000 for 12 h compared with that in the control group (P < 0.05), suggesting remarkably reduced ΔΨm and activated intrinsic apoptosis (Fig. 3b).

Intrinsic and extrinsic apoptosis were involved in E. faecalis-infected osteoblasts

Extrinsic and intrinsic apoptosis is initiated by activation of caspase-8 and caspase-9, respectively [25]. These activated initiator caspases can activate executioner caspase-3 to promote apoptosis [26]. To evaluate apoptosis in osteoblasts infected with E. faecalis OG1RF, we performed activity assays of caspase-3/-8/-9. Compared with that in the non-infected cells, the activity of caspase-3/-8/-9 was significantly increased in osteoblasts following infection at an MOI of 1000 for 12 h (P < 0.01), indicating that both intrinsic and extrinsic apoptotic pathways were involved. (Fig. 4).

E. faecalis infection induced changes in mRNA expression of apoptosis-related genes in primary osteoblasts

To identify the mRNA expression profile of apoptosis-related genes in osteoblasts infected with E. faecalis OG1RF at an MOI of 1,000 for 12 h, we performed PCR array analysis. Of all the 84 apoptosis-related genes in the PCR array, the expression of 16 genes was upregulated and that of four genes was downregulated in the infected cells compared with the non-infected cells, indicating the activation of apoptosis (fold change > 2 and P < 0.05) (Fig. 5, Table 2). Notably, within the BCL-2 family, the mRNA expression of anti-apoptotic BCL2 was downregulated, whereas that of pro-apoptotic BCL2L11, HRK, and BIK and anti-apoptotic BCL2A1 was upregulated, in the infected cells. There were no changes in the mRNA levels of BAD, BID, BCL2L1, BAK, BAX, BCL2L2 (also known as BCLW), BCL2L10 (also known as BCLB), and MCL1 (fold change < 2 or P > 0.05).
Table 2
Apoptosis-related genes in E. faecalis-infected osteoblasts compared to the control sample
Rank
Gene
Accession number
Description
Fold change
Upregulated
 1
TNF
NM_000594
Tumour necrosis factor
239.50**
 2
TNFRSF9
NM_001561
Tumour necrosis factor receptor superfamily, member 9
30.73*
 3
LTA
NM_000595
Lymphotoxin alpha (TNF superfamily, member 1)
29.13**
 4
CD70
NM_001252
CD70 molecule
24.76**
 5
BCL2A1
NM_004049
BCL2-related protein A1
14.92**
 6
CASP10
NM_001230
Caspase 10, apoptosis-related cysteine peptidase
11.04**
 7
TNFRSF10
NM_003810
Tumour necrosis factor (ligand) superfamily, member 10
10.52*
 8
TNFRSF8
NM_001244
Tumour necrosis factor (ligand) superfamily, member 8
10.19**
 9
BCL2L11
NM_006538
BCL2-like 11
6.78**
 10
CASP3
NM_004346
Caspase 3, apoptosis-related cysteine peptidase
3.40**
 11
HRK
NM_003806
Harakiri, BCL2-interacting protein
2.64*
 12
CASP9
NM_001229
Caspase 9, apoptosis-related cysteine peptidase
2.61**
 13
CASP8
NM_001228
Caspase 8, apoptosis-related cysteine peptidase
2.57**
 14
TNFRSF1B
NM_001066
Tumour necrosis factor receptor superfamily, member 1B
2.41**
 15
BIK
NM_001197
BCL2-interacting killer
2.20**
 16
APAF1
NM_001160
Apoptotic peptidase activating factor 1
2.21**
Downregulated
 1
BCL2
NM_000633
B-cell CLL/lymphoma 2
0.42*
 2
NAIP
NM_004536
NLR family, apoptosis inhibitory protein
0.41**
 3
BIRC6
NM_016252
Baculoviral IAP repeat containing 6
0.36**
 4
XIAP
NM_001167
X-linked inhibitor of apoptosis
0.30**
Primary osteoblasts were incubated with E. faecalis OG1RF at an MOI of 1,000 for 12  h. Apoptosis-related genes (fold change > 2, P < 0.05). *P < 0.05 and **P < 0.01 versus the control group

Validation of the expression of apoptosis-related genes in osteoblasts infected with E. faecalis

To validate the results of the PCR array and further evaluate the expression of other BCL-2 family members, we performed qRT-PCR. The mRNA expression of BCL2 was decreased, whereas that of BCL2L11, HRK, BIK, BCL2A1, and CASP10 was increased, in osteoblasts infected at an MOI of 1,000 for 12 h (P < 0.05). The expression of BAD and BAX did not change, confirming the results of the PCR array analysis. In addition, the expression of pro-apoptotic BMF, NOXA, and BECN1 was upregulated, whereas that of PUMA, MULE, and BCL2L12 was not altered (Fig. 6a–n). BOK expression was not detected.

Discussion

PAP, a common endodontic disease induced by bacterial infection and consequent inflammatory responses, is characterised by persistent bone destruction in the periapical region [1]. Recent studies have shown that PAP lesion is associated with osteoblast apoptosis, suggesting a role of osteoblast apoptosis in the pathogenesis of PAP [27, 28]. E. faecalis, as one of the primary pathogens in PAP, has been reported to be highly associated with endodontic infection, promoting the disruption of bone homeostasis [9]. Hence, it is crucial to examine the role of E. faecalis on osteoblast apoptosis in PAP. Our previous study found that E. faecalis strains from the root canals of teeth with PAP trigger apoptosis in mouse MC3TE-E1 and human MG63 cell lines [10, 12]. However, the effect of E. faecalis on apoptosis in human primary osteoblasts and its mechanisms remain unclear.
In the present study, E. faecalis infection increased the number of TUNEL-positive cells and apoptotic cells in the early and late phases, which was also observed in our previous study on MC3T3-E1 and MG63 cells infected with E. faecalis [10, 12]. We also noticed that necrotic cells of which the cell membrane integrity is damaged may also be stained as Annexin V-FITC/PI double-positive, as previous studies reported [29, 30]. In this study, we observed that E. faecalis infection with a higher MOI can trigger more late apoptotic cells (and necrotic cells, if any), whereas a lower MOI infection induced more early apoptotic cells, suggesting that E. faecalis infection causes osteoblast apoptosis (and necrosis, if any) in an MOI-dependent way. Additionally, the mRNA expression level and activity of caspase-3/-8/-9 were elevated in the infected osteoblast group, indicating that both intrinsic and extrinsic apoptosis were activated in the osteoblasts infected with E. faecalis OG1RF. More precisely, the significantly decreased ΔΨm and increased expression of apoptotic peptidase activating factor 1 (APAF1) indicated the activation of intrinsic apoptosis, whereas the enhanced expression of caspase-10, which is a homologue of caspase-8, indicated the activation of the extrinsic pathway [31]. Moreover, the upregulation of TNFRSF1B, TNFRSF8, TNFRSF9, and TNFRSF10 expression, as well as elevated levels of TNF, suggested apoptotic signal transition through the TNF family membrane receptors, which was also detected in tumour cells treated with chemotherapeutic drugs [32, 33]. Furthermore, the expression of caspase inhibitors NAIP, BIRC6, and XIAP was also downregulated, indicating the promotion of apoptosis. Taken all together, these data demonstrated that both intrinsic and extrinsic apoptosis were involved in human primary osteoblasts infected with E. faecalis.
To further explore the activation of the intrinsic apoptotic pathway, we analysed the expression profile of the BCL-2 family in E. faecalis-infected osteoblasts. The BCL-2 family has two subfamilies: anti-apoptotic and pro-apoptotic [34]. The anti-apoptotic members BCL-2, BCL2L1, BCL2L2, BCL2L10, BCL2A1, BCL2L12, and MCL1 exert their function via the sequestration of the pro-apoptotic members. The pro-apoptotic subfamily is further categorised into multi-domain executioners (BAK, BAX, and BOK) and the BH3-only proteins that possess only the BCL-2 homology (BH) 3 domain. The BH3-only activators, BCL2L11, BID, PUMA, and MULE, interact with both pro-apoptotic executioners and anti-apoptotic members to trigger apoptosis, whereas BH3-only sensitisers (BAD, BMF, HRK, NOXA, BIK, and Beclin-1) displace the BH3-only activators and executioners from the anti-apoptotic protein heteromeric complex to promote apoptosis [35]. The interplay between the BCL-2 family members triggers the multi-domain executioner oligomerisation on the mitochondrial membrane, resulting in mitochondrial outer membrane permeabilization (MOMP) and subsequent activation of the caspase cascade [36]. Here, we found that the mRNA expression of anti-apoptotic BCL2 was downregulated, whereas that of pro-apoptotic BCL2L11, HRK, BIK, BMF, NOXA, and BECN1 was upregulated in the infected cells. Downregulated BCL2 expression was also detected in MC3T3-E1 cells infected with E. faecalis [10]. Moreover, it has also been reported that the activator BCL2L11 and sensitisers Beclin-1 and BIK participate in osteoblast-like cell apoptosis induced by glucocorticoids, sodium fluoride, oxidative stress, and chemotherapeutic drugs [3740]. Furthermore, decreased expression of sensitisers BMF and NOXA may increase osteoclast survival to promote bone loss [41, 42]. However, the role of harakiri (HRK), a novel regulator of cell death, in bone homeostasis remains unclear. Evidence has shown that the inactivation of HRK in prostate cancer constitutes a critical component in decreased apoptosis of tumour cells, whereas HRK-mediated mitochondrial dysfunction contributes to enhanced apoptosis in human malignancies [43]. However, in lipopolysaccharide-stimulated osteoclasts, HRK expression is not altered [41]. In this study, we reported an increase in HRK expression in the infected osteoblasts, suggesting its role in bone remodelling in PAP. In addition, interestingly, we observed that the expression of anti-apoptotic BCL2A1 was significantly higher in the infected osteoblasts than in the control sample. The pro-survival potential of BCL2A1 is reported to be associated with its interaction with BCL2L11, BIK, HRK, NOXA, BID, and PUMA [44]. The level of BCL2A1 is enhanced in different types of cancer cells, resulting in tumour progression and chemotherapy resistance [45]. Porphyromonas gingivalis infection also induces the upregulation of BCL2A1 in epithelial cells [46]. In this study, as the mRNA levels of BCL2L11, BIK, HRK, and NOXA were increased, we inferred that the elevated BCL2A1 expression may act as a negative feedback factor that interacts with these four aforementioned BH3-only proteins to protect the infected osteoblasts from apoptosis. Evidently, our data suggested that these BCL-2 family members play important roles in E. faecalis-induced osteoblast apoptosis. Further studies are needed to elucidate the exact role and mechanism of the interaction of BCL-2 family members in the pathogenesis of PAP and their possible role(s) in the relationship of PAP with system diseases.

Conclusions

In conclusion, our findings demonstrated that E. faecalis OG1RF induced apoptosis in human primary osteoblasts, and both the extrinsic and intrinsic pathways were involved. Anti-apoptotic BCL-2 and BCL2A1, and pro-apoptotic BCL2L11, HRK, BIK, BMF, NOXA, and Beclin-1 were also involved in osteoblast apoptosis induced by E. faecalis (Fig. 7). These results suggest that BCL-2 family members act as novel regulators of osteoblast apoptosis induced by E. faecalis and are, thus, potential therapeutic targets for PAP treatment.

Acknowledgements

Figure 7 was created with BioRender online tool.

Declarations

Not applicable.

Competing interests

The authors declare that they have no competing interests.
Not applicable.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Davanian H, Gaiser RA, Silfverberg M, Hugerth LW, Sobkowiak MJ, Lu L, et al. Mucosal-associated invariant T cells and oral microbiome in persistent apical periodontitis. Int J Oral Sci. 2019;11(2):16.PubMedPubMedCentralCrossRef Davanian H, Gaiser RA, Silfverberg M, Hugerth LW, Sobkowiak MJ, Lu L, et al. Mucosal-associated invariant T cells and oral microbiome in persistent apical periodontitis. Int J Oral Sci. 2019;11(2):16.PubMedPubMedCentralCrossRef
4.
5.
Zurück zum Zitat Zhang F, Qiu Q, Song X, Chen Y, Wu J, Liang M. Signal-regulated protein kinases/protein kinase B-p53-BH3-interacting domain death agonist pathway regulates Gingipain-induced apoptosis in osteoblasts. J Periodontol. 2017;88(11):e200–10.PubMedCrossRef Zhang F, Qiu Q, Song X, Chen Y, Wu J, Liang M. Signal-regulated protein kinases/protein kinase B-p53-BH3-interacting domain death agonist pathway regulates Gingipain-induced apoptosis in osteoblasts. J Periodontol. 2017;88(11):e200–10.PubMedCrossRef
6.
Zurück zum Zitat Tian Y, Zhang X, Zhang K, Song Z, Wang R, Huang S, et al. Effect of Enterococcus faecalis lipoteichoic acid on apoptosis in human osteoblast-like cells. J Endod. 2013;39(5):632–7.PubMedCrossRef Tian Y, Zhang X, Zhang K, Song Z, Wang R, Huang S, et al. Effect of Enterococcus faecalis lipoteichoic acid on apoptosis in human osteoblast-like cells. J Endod. 2013;39(5):632–7.PubMedCrossRef
7.
Zurück zum Zitat Al-Sakati H, Kowollik S, Gabris S, Balasiu A, Ommerborn M, Pfeffer K, et al. The benefit of culture-independent methods to detect bacteria and fungi in re-infected root filled teeth: a pilot study. Int Endod J. 2021;54(1):74–84.PubMedCrossRef Al-Sakati H, Kowollik S, Gabris S, Balasiu A, Ommerborn M, Pfeffer K, et al. The benefit of culture-independent methods to detect bacteria and fungi in re-infected root filled teeth: a pilot study. Int Endod J. 2021;54(1):74–84.PubMedCrossRef
8.
Zurück zum Zitat Zhang C, Du J, Peng Z. Correlation between enterococcus faecalis and persistent intraradicular infection compared with primary intraradicular infection: A systematic review. J Endod. 2015;41(8):1207–13.PubMedCrossRef Zhang C, Du J, Peng Z. Correlation between enterococcus faecalis and persistent intraradicular infection compared with primary intraradicular infection: A systematic review. J Endod. 2015;41(8):1207–13.PubMedCrossRef
9.
Zurück zum Zitat Barbosa-Ribeiro M, Arruda-Vasconcelos R, Louzada LM, Dos Santos DG, Andreote FD, Gomes B. Microbiological analysis of endodontically treated teeth with apical periodontitis before and after endodontic retreatment. Clin Oral Investig. 2021;25(4):2017–27.PubMedCrossRef Barbosa-Ribeiro M, Arruda-Vasconcelos R, Louzada LM, Dos Santos DG, Andreote FD, Gomes B. Microbiological analysis of endodontically treated teeth with apical periodontitis before and after endodontic retreatment. Clin Oral Investig. 2021;25(4):2017–27.PubMedCrossRef
10.
Zurück zum Zitat Li Y, Tong Z, Ling J. Effect of the three Enterococcus faecalis strains on apoptosis in MC3T3 cells. Oral Dis. 2019;25(1):309–18.PubMedCrossRef Li Y, Tong Z, Ling J. Effect of the three Enterococcus faecalis strains on apoptosis in MC3T3 cells. Oral Dis. 2019;25(1):309–18.PubMedCrossRef
11.
Zurück zum Zitat Ran S, Chu M, Gu S, Wang J, Liang J. Enterococcus faecalis induces apoptosis and pyroptosis of human osteoblastic MG63 cells via the NLRP3 inflammasome. Int Endod J. 2019;52(1):44–53.PubMedCrossRef Ran S, Chu M, Gu S, Wang J, Liang J. Enterococcus faecalis induces apoptosis and pyroptosis of human osteoblastic MG63 cells via the NLRP3 inflammasome. Int Endod J. 2019;52(1):44–53.PubMedCrossRef
13.
Zurück zum Zitat Karygianni L, Wiedmann-Al-Ahmad M, Finkenzeller G, Sauerbier S, Wolkewitz M, Hellwig E, et al. Enterococcus faecalis affects the proliferation and differentiation of ovine osteoblast-like cells. Clin Oral Investig. 2012;16(3):879–87.PubMedCrossRef Karygianni L, Wiedmann-Al-Ahmad M, Finkenzeller G, Sauerbier S, Wolkewitz M, Hellwig E, et al. Enterococcus faecalis affects the proliferation and differentiation of ovine osteoblast-like cells. Clin Oral Investig. 2012;16(3):879–87.PubMedCrossRef
14.
Zurück zum Zitat Liu M, Dickinson-Copeland C, Hassana S, Stiles JK. Plasmodium-infected erythrocytes (pRBC) induce endothelial cell apoptosis via a heme-mediated signaling pathway. Drug Des Devel Ther. 2016;10:1009–18.PubMedPubMedCentralCrossRef Liu M, Dickinson-Copeland C, Hassana S, Stiles JK. Plasmodium-infected erythrocytes (pRBC) induce endothelial cell apoptosis via a heme-mediated signaling pathway. Drug Des Devel Ther. 2016;10:1009–18.PubMedPubMedCentralCrossRef
15.
16.
Zurück zum Zitat Singh R, Letai A, Sarosiek K. Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nat Rev Mol Cell Biol. 2019;20(3):175–93.PubMedPubMedCentralCrossRef Singh R, Letai A, Sarosiek K. Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nat Rev Mol Cell Biol. 2019;20(3):175–93.PubMedPubMedCentralCrossRef
17.
Zurück zum Zitat Knight T, Luedtke D, Edwards H, Taub JW, Ge Y. A delicate balance - the BCL-2 family and its role in apoptosis, oncogenesis, and cancer therapeutics. Biochem Pharmacol. 2019;162:250–61.PubMedCrossRef Knight T, Luedtke D, Edwards H, Taub JW, Ge Y. A delicate balance - the BCL-2 family and its role in apoptosis, oncogenesis, and cancer therapeutics. Biochem Pharmacol. 2019;162:250–61.PubMedCrossRef
18.
Zurück zum Zitat Bueno MR, Ishikawa KH, Almeida-Santos G, Ando-Suguimoto ES, Shimabukuro N, Kawamoto D, et al. Lactobacilli attenuate the effect of Aggregatibacter actinomycetemcomitans infection in gingival epithelial cells. Front Microbiol. 2022;13: 846192.PubMedPubMedCentralCrossRef Bueno MR, Ishikawa KH, Almeida-Santos G, Ando-Suguimoto ES, Shimabukuro N, Kawamoto D, et al. Lactobacilli attenuate the effect of Aggregatibacter actinomycetemcomitans infection in gingival epithelial cells. Front Microbiol. 2022;13: 846192.PubMedPubMedCentralCrossRef
19.
Zurück zum Zitat Figueredo CM, Alves JC, de Souza Breves Beiler TFC, Fischer RG,. Anti-apoptotic traits in gingival tissue from patients with severe generalized chronic periodontitis. J Investig Clin Dent. 2019;10(3):e12422.PubMedCrossRef Figueredo CM, Alves JC, de Souza Breves Beiler TFC, Fischer RG,. Anti-apoptotic traits in gingival tissue from patients with severe generalized chronic periodontitis. J Investig Clin Dent. 2019;10(3):e12422.PubMedCrossRef
20.
Zurück zum Zitat Sobocki BK, Basset CA, Bruhn-Olszewska B, Olszewski P, Szot O, Kazmierczak-Siedlecka K, et al. Molecular mechanisms leading from periodontal disease to cancer. Int J Mol Sci. 2022;23(2):970.PubMedPubMedCentralCrossRef Sobocki BK, Basset CA, Bruhn-Olszewska B, Olszewski P, Szot O, Kazmierczak-Siedlecka K, et al. Molecular mechanisms leading from periodontal disease to cancer. Int J Mol Sci. 2022;23(2):970.PubMedPubMedCentralCrossRef
21.
Zurück zum Zitat Gold OG, Jordan HV, van Houte J. The prevalence of enterococci in the human mouth and their pathogenicity in animal models. Arch Oral Biol. 1975;20(7):473–7.PubMedCrossRef Gold OG, Jordan HV, van Houte J. The prevalence of enterococci in the human mouth and their pathogenicity in animal models. Arch Oral Biol. 1975;20(7):473–7.PubMedCrossRef
22.
Zurück zum Zitat Huo W, Adams HM, Zhang MQ, Palmer KL. Genome modification in Enterococcus faecalis OG1RF assessed by bisulfite sequencing and single-molecule real-time sequencing. J Bacteriol. 2015;197(11):1939–51.PubMedPubMedCentralCrossRef Huo W, Adams HM, Zhang MQ, Palmer KL. Genome modification in Enterococcus faecalis OG1RF assessed by bisulfite sequencing and single-molecule real-time sequencing. J Bacteriol. 2015;197(11):1939–51.PubMedPubMedCentralCrossRef
23.
Zurück zum Zitat Chavez de Paz LE, Davies JR, Bergenholtz G, Svensater G. Strains of Enterococcus faecalis differ in their ability to coexist in biofilms with other root canal bacteria. Int Endod J. 2015;48(10):916–25.PubMedCrossRef Chavez de Paz LE, Davies JR, Bergenholtz G, Svensater G. Strains of Enterococcus faecalis differ in their ability to coexist in biofilms with other root canal bacteria. Int Endod J. 2015;48(10):916–25.PubMedCrossRef
24.
Zurück zum Zitat Minavi B, Youssefi A, Quock R, Letra A, Silva R, Kirkpatrick TC, et al. Evaluating the substantivity of silver diamine fluoride in a dentin model. Clin Exp Dent Res. 2021;7(4):628–33.PubMedCrossRef Minavi B, Youssefi A, Quock R, Letra A, Silva R, Kirkpatrick TC, et al. Evaluating the substantivity of silver diamine fluoride in a dentin model. Clin Exp Dent Res. 2021;7(4):628–33.PubMedCrossRef
25.
Zurück zum Zitat Messmer MN, Snyder AG, Oberst A. Comparing the effects of different cell death programs in tumor progression and immunotherapy. Cell Death Differ. 2019;26(1):115–29.PubMedCrossRef Messmer MN, Snyder AG, Oberst A. Comparing the effects of different cell death programs in tumor progression and immunotherapy. Cell Death Differ. 2019;26(1):115–29.PubMedCrossRef
26.
27.
Zurück zum Zitat Yang CN, Kok SH, Wang HW, Chang JZ, Lai EH, Shun CT, et al. Simvastatin alleviates bone resorption in apical periodontitis possibly by inhibition of mitophagy-related osteoblast apoptosis. Int Endod J. 2019;52(5):676–88.PubMedCrossRef Yang CN, Kok SH, Wang HW, Chang JZ, Lai EH, Shun CT, et al. Simvastatin alleviates bone resorption in apical periodontitis possibly by inhibition of mitophagy-related osteoblast apoptosis. Int Endod J. 2019;52(5):676–88.PubMedCrossRef
28.
Zurück zum Zitat Yang CN, Lin SK, Kok SH, Wang HW, Lee YL, Shun CT, et al. The possible role of sirtuin 5 in the pathogenesis of apical periodontitis. Oral Dis. 2020;27(7):1766–74.CrossRef Yang CN, Lin SK, Kok SH, Wang HW, Lee YL, Shun CT, et al. The possible role of sirtuin 5 in the pathogenesis of apical periodontitis. Oral Dis. 2020;27(7):1766–74.CrossRef
29.
Zurück zum Zitat Chen S, Cheng AC, Wang MS, Peng X. Detection of apoptosis induced by new type gosling viral enteritis virus in vitro through fluorescein annexin V-FITC/PI double labeling. World J Gastroenterol. 2008;14(14):2174–8.PubMedPubMedCentralCrossRef Chen S, Cheng AC, Wang MS, Peng X. Detection of apoptosis induced by new type gosling viral enteritis virus in vitro through fluorescein annexin V-FITC/PI double labeling. World J Gastroenterol. 2008;14(14):2174–8.PubMedPubMedCentralCrossRef
30.
Zurück zum Zitat Cui XZ, Zheng MX, Yang SY, Bai R, Zhang L. Roles of calpain in the apoptosis of Eimeria tenella host cells at the middle and late developmental stages. Parasitol Res. 2022;121(6):1639–49.PubMedCrossRef Cui XZ, Zheng MX, Yang SY, Bai R, Zhang L. Roles of calpain in the apoptosis of Eimeria tenella host cells at the middle and late developmental stages. Parasitol Res. 2022;121(6):1639–49.PubMedCrossRef
31.
Zurück zum Zitat Kumari R, Deshmukh RS, Das S. Caspase-10 inhibits ATP-citrate lyase-mediated metabolic and epigenetic reprogramming to suppress tumorigenesis. Nat Commun. 2019;10(1):4255.PubMedPubMedCentralCrossRef Kumari R, Deshmukh RS, Das S. Caspase-10 inhibits ATP-citrate lyase-mediated metabolic and epigenetic reprogramming to suppress tumorigenesis. Nat Commun. 2019;10(1):4255.PubMedPubMedCentralCrossRef
32.
Zurück zum Zitat Ke R, Vishnoi K, Viswakarma N, Santha S, Das S, Rana A, et al. Involvement of AMP-activated protein kinase and death receptor 5 in Trail-Berberine-induced apoptosis of cancer cells. Sci Rep. 2018;8(1):5521.PubMedPubMedCentralCrossRef Ke R, Vishnoi K, Viswakarma N, Santha S, Das S, Rana A, et al. Involvement of AMP-activated protein kinase and death receptor 5 in Trail-Berberine-induced apoptosis of cancer cells. Sci Rep. 2018;8(1):5521.PubMedPubMedCentralCrossRef
33.
Zurück zum Zitat Kaur P, Dhandayuthapani S, Venkatesan T, Gantor M, Rathinavelu A. Molecular mechanism of C-phycocyanin induced apoptosis in LNCaP cells. Bioorg Med Chem. 2020;28(3): 115272.PubMedCrossRef Kaur P, Dhandayuthapani S, Venkatesan T, Gantor M, Rathinavelu A. Molecular mechanism of C-phycocyanin induced apoptosis in LNCaP cells. Bioorg Med Chem. 2020;28(3): 115272.PubMedCrossRef
34.
Zurück zum Zitat Pemberton JM, Pogmore JP, Andrews DW. Neuronal cell life, death, and axonal degeneration as regulated by the BCL-2 family proteins. Cell Death Differ. 2021;28(1):108–22.PubMedCrossRef Pemberton JM, Pogmore JP, Andrews DW. Neuronal cell life, death, and axonal degeneration as regulated by the BCL-2 family proteins. Cell Death Differ. 2021;28(1):108–22.PubMedCrossRef
36.
Zurück zum Zitat Glab JA, Cao Z, Puthalakath H. Bcl-2 family proteins, beyond the veil. Int Rev Cell Mol Biol. 2020;351:1–22.PubMedCrossRef Glab JA, Cao Z, Puthalakath H. Bcl-2 family proteins, beyond the veil. Int Rev Cell Mol Biol. 2020;351:1–22.PubMedCrossRef
37.
Zurück zum Zitat Espina B, Liang M, Russell RG, Hulley PA. Regulation of bim in glucocorticoid-mediated osteoblast apoptosis. J Cell Physiol. 2008;215(2):488–96.PubMedPubMedCentralCrossRef Espina B, Liang M, Russell RG, Hulley PA. Regulation of bim in glucocorticoid-mediated osteoblast apoptosis. J Cell Physiol. 2008;215(2):488–96.PubMedPubMedCentralCrossRef
38.
Zurück zum Zitat Zhang Q, Zhao L, Shen Y, He Y, Cheng G, Yin M, et al. Curculigoside protects against excess-iron-induced bone loss by attenuating Akt-FoxO1-dependent oxidative damage to mice and osteoblastic MC3T3-E1 cells. Oxid Med Cell Longev. 2019;2019:9281481.PubMedPubMedCentral Zhang Q, Zhao L, Shen Y, He Y, Cheng G, Yin M, et al. Curculigoside protects against excess-iron-induced bone loss by attenuating Akt-FoxO1-dependent oxidative damage to mice and osteoblastic MC3T3-E1 cells. Oxid Med Cell Longev. 2019;2019:9281481.PubMedPubMedCentral
39.
Zurück zum Zitat Zhang YL, Luo Q, Deng Q, Li T, Li Y, Zhang ZL, et al. Genes associated with sodium fluoride-induced human osteoblast apoptosis. Int J Clin Exp Med. 2015;8(8):13171–8.PubMedPubMedCentral Zhang YL, Luo Q, Deng Q, Li T, Li Y, Zhang ZL, et al. Genes associated with sodium fluoride-induced human osteoblast apoptosis. Int J Clin Exp Med. 2015;8(8):13171–8.PubMedPubMedCentral
40.
Zurück zum Zitat Chiabotto G, Grignani G, Todorovic M, Martin V, Centomo ML, Prola E, et al. Pazopanib and trametinib as a synergistic strategy against osteosarcoma: preclinical activity and molecular insights. Cancer (Basel). 2020;12(6):1519.PubMedCentralCrossRef Chiabotto G, Grignani G, Todorovic M, Martin V, Centomo ML, Prola E, et al. Pazopanib and trametinib as a synergistic strategy against osteosarcoma: preclinical activity and molecular insights. Cancer (Basel). 2020;12(6):1519.PubMedCentralCrossRef
41.
Zurück zum Zitat Sul OJ, Rajasekaran M, Park HJ, Suh JH, Choi HS. MicroRNA-29b enhances osteoclast survival by targeting BCL-2-modifying factor after lipopolysaccharide stimulation. Oxid Med Cell Longev. 2019;2019:6018180.PubMedPubMedCentralCrossRef Sul OJ, Rajasekaran M, Park HJ, Suh JH, Choi HS. MicroRNA-29b enhances osteoclast survival by targeting BCL-2-modifying factor after lipopolysaccharide stimulation. Oxid Med Cell Longev. 2019;2019:6018180.PubMedPubMedCentralCrossRef
42.
Zurück zum Zitat Idrus E, Nakashima T, Wang L, Hayashi M, Okamoto K, Kodama T, et al. The role of the BH3-only protein Noxa in bone homeostasis. Biochem Biophys Res Commun. 2011;410(3):620–5.PubMedCrossRef Idrus E, Nakashima T, Wang L, Hayashi M, Okamoto K, Kodama T, et al. The role of the BH3-only protein Noxa in bone homeostasis. Biochem Biophys Res Commun. 2011;410(3):620–5.PubMedCrossRef
43.
Zurück zum Zitat Nakamura M, Shimada K, Konishi N. The role of HRK gene in human cancer. Oncogene. 2008;27(Suppl 1):S105–13.PubMedCrossRef Nakamura M, Shimada K, Konishi N. The role of HRK gene in human cancer. Oncogene. 2008;27(Suppl 1):S105–13.PubMedCrossRef
44.
Zurück zum Zitat Garcia-Aranda M, Perez-Ruiz E, Redondo M. Bcl-2 Inhibition to overcome resistance to chemo and immunotherapy. Int J Mol Sci. 2018;19(12):3950.PubMedCentralCrossRef Garcia-Aranda M, Perez-Ruiz E, Redondo M. Bcl-2 Inhibition to overcome resistance to chemo and immunotherapy. Int J Mol Sci. 2018;19(12):3950.PubMedCentralCrossRef
45.
46.
Zurück zum Zitat Zhu X, Zhang K, Lu K, Shi T, Shen S, Chen X, et al. Inhibition of pyroptosis attenuates staphylococcus aureus-induced bone injury in traumatic osteomyelitis. Ann Transl Med. 2019;7(8):170.PubMedPubMedCentralCrossRef Zhu X, Zhang K, Lu K, Shi T, Shen S, Chen X, et al. Inhibition of pyroptosis attenuates staphylococcus aureus-induced bone injury in traumatic osteomyelitis. Ann Transl Med. 2019;7(8):170.PubMedPubMedCentralCrossRef
Metadaten
Titel
Effect of Enterococcus faecalis OG1RF on human calvarial osteoblast apoptosis
verfasst von
Yang Li
Shuyu Sun
Cheng Wen
Jialin Zhong
Qianzhou Jiang
Publikationsdatum
01.12.2022
Verlag
BioMed Central
Erschienen in
BMC Oral Health / Ausgabe 1/2022
Elektronische ISSN: 1472-6831
DOI
https://doi.org/10.1186/s12903-022-02295-y

Weitere Artikel der Ausgabe 1/2022

BMC Oral Health 1/2022 Zur Ausgabe

„Übersichtlicher Wegweiser“: Lauterbachs umstrittener Klinik-Atlas ist online

17.05.2024 Klinik aktuell Nachrichten

Sie sei „ethisch geboten“, meint Gesundheitsminister Karl Lauterbach: mehr Transparenz über die Qualität von Klinikbehandlungen. Um sie abzubilden, lässt er gegen den Widerstand vieler Länder einen virtuellen Klinik-Atlas freischalten.

Klinikreform soll zehntausende Menschenleben retten

15.05.2024 Klinik aktuell Nachrichten

Gesundheitsminister Lauterbach hat die vom Bundeskabinett beschlossene Klinikreform verteidigt. Kritik an den Plänen kommt vom Marburger Bund. Und in den Ländern wird über den Gang zum Vermittlungsausschuss spekuliert.

Darf man die Behandlung eines Neonazis ablehnen?

08.05.2024 Gesellschaft Nachrichten

In einer Leseranfrage in der Zeitschrift Journal of the American Academy of Dermatology möchte ein anonymer Dermatologe bzw. eine anonyme Dermatologin wissen, ob er oder sie einen Patienten behandeln muss, der eine rassistische Tätowierung trägt.

Ein Drittel der jungen Ärztinnen und Ärzte erwägt abzuwandern

07.05.2024 Klinik aktuell Nachrichten

Extreme Arbeitsverdichtung und kaum Supervision: Dr. Andrea Martini, Sprecherin des Bündnisses Junge Ärztinnen und Ärzte (BJÄ) über den Frust des ärztlichen Nachwuchses und die Vorteile des Rucksack-Modells.

Update Zahnmedizin

Bestellen Sie unseren kostenlosen Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.