Introduction
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and irreversible lung disease characterized by the aberrant accumulation of fibrotic tissue in the lung parenchyma [
1,
2]. At present, IPF pathogenesis is not completely understood, but pulmonary fibroblasts and epithelial cells, as the main functional cells, play essential roles in the progression of pulmonary fibrosis [
3‐
5]. Alveoli are important structures of the lung and consist of epithelial cells, and these cells play an essential role in maintaining the size and gas exchange of the lung (oxygen and carbon dioxide) [
6‐
8]. The main role of pulmonary fibroblasts is to participate in lung wound healing, and unlimited fibroblast proliferation can cause excessive repair of the lung, which exacerbates the progression of pulmonary fibrosis and the induction of pulmonary function [
8‐
10].
Transforming growth factor-β1 (TGF-β1) is involved in the development of fibrosis in various organs [
11]. TGF-β1 expression levels are increased in IPF patients compared to normal controls, and this cytokine aggravates the progression of pulmonary fibrosis by upregulating Smad and non-Smad signals [
11]. Mechanical tension activates the TGF-β signalling pathway in type II alveolar epithelial cells, and reducing this signalling pathway may be a sufficient strategy to alleviate fibrotic progression in IPF patients [
12]. Smads from the cell membrane and nucleus have been identified in fibroblasts after TGF-β1 treatment, and Smad3 deficiency attenuates bleomycin-induced pulmonary fibrosis [
13]. In addition, TGF-β1 activates non-Smad signalling pathways, such as activating the Akt kinase by targeting PTEN [
14], activating the Erk kinase through direct phosphorylation of ShcA [
15] and activating the JNK kinase through the FRAF6 protein [
16]. TGF-β1 is a potent profibrotic cytokine in foci containing these activated fibroblasts, and it induces fibroblasts to transform into myofibroblasts in the lung [
17]. Extracellular matrix (ECM) proteins are an essential determinant of wound healing and are mainly secreted by myofibroblasts, and TGF-β1 significantly promotes fibroblast activation, migration and ECM accumulation in the lungs of IPF patients [
18].
Avitinib (AC0010 or AVB) is an irreversible epidermal growth factor receptor (EGFR) inhibitor that selectively targets T790-mutated EGFR, and it is used in the treatment of NSCLC [
19]. In addition, avitinib also acts as a novel Bruton’s tyrosine kinase (BTK) inhibitor, which inhibits the phosphorylation of BTK and the PI3K/Akt signalling pathway in mononuclear cell leukaemia (MCL) cells [
20]. Previous studies have demonstrated that targeting EGFR and BTK may be an effective method to mediate the development of pulmonary fibrosis [
21,
22]. In the present study, we used in vivo and in vitro models to evaluate the role of avitinib in pulmonary fibrosis(Fig. S
1), and we further explored the pharmacological mechanism of avitinib in the treatment of lung fibrosis, aiming to provide novel candidate compounds for clinical treatment of lung fibrosis.
Materials and methods
Animals
In total, 60 male C57BL/6 J mice (6–8 weeks old and average weight at the start of the experiment was 20–22 g) were purchased from Charles River (Beijing, China). The mice were housed at the Experimental Animal Centre of Nankai University under good growth and living conditions. The care and experimental procedures complied with guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of Nankai University (Permit No. SYXK 2019–0001). All mice were provided unlimited access to food and water, and they were maintained under a 12-h light–dark cycle with 60% ± 2% air humidity at 22 °C–26 °C. C57BL/6 J mice are the predominant animal model for lung injury as this particular strain is highly susceptible to lung injury following intratracheal BLM administration [
23,
24].
Bleomycin (Medicine Co., Tokyo, Japan) was dissolved in 0.9% normal saline (Sangon, Shanghai, China) and administered through intratracheal instillation (2 U/kg). Mice in the NaCl group received 0.9% normal saline only by intratracheal instillation. The 60 mice were randomly categorized into the following 6 groups: NaCl group (
n = 6), bleomycin (2 U/kg) group (
n = 6), bleomycin + nintedanib (100 mg/kg) group (
n = 6), bleomycin + avitinib (15 mg/kg) group (
n = 6), bleomycin + avitinib (30 mg/kg) group (
n = 6) and bleomycin + avitinib (60 mg/kg) group (
n = 6). According to other studies and the long-term experimental doses used in our previously published articles [
20,
25,
26], we selected the effective and nontoxic concentrations of the drugs for studies of avitinib and nintedanib. The mice were given oral nintedanib (Macklin, Shanghai, China) and avitinib (Gage Bio, Jinan, China), both of which were administered once a day for 7 days (Day 7 to Day 13 after bleomycin administration) [
27]. Lung tissues were harvested on Day 14 for subsequent experiments. For anaesthesia, 40 mg/kg pentobarbital sodium was used via intraperitoneal injection [
28,
29]. We selected nintedanib as a positive control because nintedanib is one of two drugs approved to treat IPF patients, and it is also used as a positive control agent in many relevant studies.
Western blot analysis
RIPA buffer (Beyotime, Shanghai, China) containing a protease inhibitor cocktail (Sigma, Rehovot, Israel) was used to lyse cells and tissues, and the protein concentrations of the supernatant were analysed using the BCA Protein Assay kit (Beyotime, Shanghai, China). SDS–PAGE was used to separate proteins based on molecular weight, and all proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Roche Diagnostics, Indianapolis, IN, USA). The membranes were blocked with 5% BSA (Cell Signaling Technology, Beverly, MA, USA) in TBS-T for one hour at room temperature and then incubated overnight at 4 °C with the primary antibodies shown in Table
1. The membranes were then incubated with secondary antibodies for approximately 2 h at room temperature. HRP-labelled goat anti-rabbit IgG (H + L) (Cell Signaling Technology, Beverly, MA, USA) and HRP-labelled goat anti-mouse IgG (H + L) (Cell Signaling Technology, Beverly, MA, USA) were used as the secondary antibodies. Immunoreactivity was detected by ECL (Affinity Biosciences, OH, USA), and the relative density was analysed by ImageJ.
Table 1
List of primary antibodies
p-Smad2(S467) | Affinity, AF3449 | p-Smad3 (S423/425) | Affinity, AF8315 |
Smad2 | Affinity, AF6449 | Smad3 | Affinity, AF6362 |
α-SMA | Affinity, BF9212 | E-Cadherin | CST, 144,725 |
Collagen I | Affinity, AF7001 | Vimentin | CST, 5741 T |
GAPDH | Affinity, AF7021 | | |
Real-time quantitative PCR
TRIzol (Thermo Scientific Inc., Waltham, MA, USA) was used to extract total RNA from NIH-3T3 and A549 cells and lung tissues. All primers (Table
2) for α-SMA (α-smooth muscle actin), Col1 1 (collagen 1), vimentin and E-cadherin were purchased from Qingke Biological Technology (Beijing, China). RNA transcription was performed using the Reverse SYBR Select Master Mix kit according to the manufacturer’s instructions (Tiangen, Beijing, China). Fluorescence quantitative real-time PCR (Yeasen, Shanghai, China) was subsequently performed.
Table 2
List of gene primers
α-SMA(mouse) | GCTGGTGATGATGCTCCCA | GCCCATTCCAACCATTACTCC |
Col1 a1(mouse) | CCAAGAAGACATCCCTGAAGTCA | TGCACGTCATCGCACACA |
E-cadherin(mouse) | CAGCCTTCTTTTCGGAAGACT | GGTAGACAGCTCCCTATGACTG |
Vimentin(mouse) | ATGACCGCTTTGCCAACTAC | GTGCCAGAGAAGCATTGTCA |
β-actin(mouse) | AGGCCAACCGTGAAAAGATG | AGAGCATAGCCCTCGTAGATGG |
E-cadherin(human) | GAGTGCCAACTGGACCATTCAGTA | AGTCACCCACCTCTAAGGCCATC |
Vimentin(human) | CCAGGCAAAGCAGGAGTC | GGGTATCAACCAGAGGGAGT |
β-actin(human) | GGACTTCGAGCAAGAGATGG | AGCACTGTGTTGGCGTACAG |
Haematoxylin–eosin (H&E) and masson’s trichrome staining and measurement of the pulmonary fibrosis area
Mouse lungs were fixed in 10% formalin for at least 2 days, and different concentrations of dimethylbenzene and ethanol were used to dehydrate lung tissues. Tissues were then embedded in paraffin, and lung Sects. (5 µm) were prepared for haematoxylin–eosin (HE) staining and Masson’s trichrome staining (Solarbio, Shanghai, China). Images of the lung structure were obtained using a fluorescence microscope (Nikon, Japan), and Image-Pro Plus Version 6.0 (Media Cybernetics Inc., Bethesda, MD, USA) was used to calculate the fibrotic area of lung tissues [
30]. The entire lung area was demarcated, and the total pixel Pw of the region was automatically calculated. The total pixel Pf of the fibrosis region was then calculated and used to calculate the fibrosis ratio using the following formula: fibrosis ratio = fibrosis area total pixel Pf/total lung total pixel Pw.
Immunohistochemistry
Immunohistochemical (IHC) analyses of mouse lung sections were performed to evaluate the protein expression levels of α-SMA, Col 1, E-cadherin and vimentin using the UltraSensitive™ SP (Mouse/Rabbit) IHC Kit and DAB Kit (Maxim, Fuzhou, China). In brief, the tissue sections were pretreated with antigen retrieval solution at high temperature (Maxim, Fuzhou, China), blocked, incubated overnight at 4 °C with primary antibodies against the targeted protein, and stained with DAB solution and haematoxylin solution. Images were obtained using a fluorescence microscope (Nikon, Tokyo, Japan).
Evaluation of pulmonary function
The mice were anaesthetized with 40 mg/kg pentobarbital sodium in 0.9% normal saline solution (i.p.). The mice were fixed to the console, and they were then sprayed with 75% alcohol for disinfection. The fur was cut from the abdomen to the mandible, and the trachea was exposed. The trocar needle was inserted from the cartilage ring and pulled out to keep the trocar tightly fastened. A mouse plethysmography chamber was used to analyse pulmonary function using the AniRes2005 Animal Lung Function Analysis System (Biolab, Beijing, China). The mice were laid in a body box, and a computer was used to assess pulmonary function indices, such as forced vital capacity (FVC), inspiratory resistance (Ri), expiratory resistance (Re), and dynamic compliance (Cydn). The sternum of the mouse was then cut, and the inferior vena cava was cut and ligated from the root of the right lung. The heart was perfused with PBS until the lungs turned white, and the heart was quickly removed. The right lung was removed from the ligation, rinsed with PBS, and placed into an ampoule bottle to determine the hydroxyproline content. A syringe was used to remove the 4% formaldehyde fixative solution from the cannula and put it through the trachea to prop up the left lung until the lung was full. Finally, the trachea and left lung were removed together and fixed in 4% formaldehyde fixative solution, which were used for subsequent lung tissue sectioning and staining.
Hydroxyproline assay
A frequently used method of analysing hydroxyproline was employed to detect the collagen content of the right lungs of mice. The right lungs were dried and subjected to acid hydrolysis. Concentrated sodium hydroxide was then used to ensure a pH value of 6.5–8.0. Chloramine-T (MERYER, Shanghai, China) spectrophotometric absorbance was employed for hydroxyproline analysis as previously described [
31]. Finally, the hydroxyproline level of the mouse right lung was measured using a spectrophotometer at a wavelength of 550 nm.
Cell culture
Human lung cancer epithelial cells (A549), mouse embryonic fibroblasts (NIH-3T3) and CAGA-NIH-3T3 cells were kindly provided by Professor Wen Ning, School of Life Sciences, Nankai University. NIH-3T3 and CAGA-NIH-3T3 cells were maintained in DMEM (Solarbio, Beijing, China) containing 10% foetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin–streptomycin (Gibco, Carlsbad, CA, USA). A549 cells were cultured in RPMI 1640 medium (Solarbio, Beijing, China) containing 10% foetal bovine serum and 1% penicillin–streptomycin. NIH-3T3, CAGA-NIH3T3 and A549 cells in DMEM or RPMI 1640 medium with 0.1% FBS were stimulated with TGF-β1 (human TGF-beta1-mammalian; Lianke Biotechnology, Hangzhou, China) or avitinib (dissolved in DMSO). All cells were cultured in an incubator (PHCBI, Tokyo, Japan) with 5% CO2 at 37 °C.
Wound-healing assays
NIH-3T3 cells were seeded into 6-well plates for the wound-healing assay, and 200-µL sterile pipette tips were used to generate a wound. Cells were cultured in AVB (1.25 and 2.5 µM) and/or TGF-β1 (5 ng/mL) in DMEM with 0.1% FBS. Images were obtained at 0, 12, and 24 h by using a light microscope (Nikon, Tokyo, Japan).
Cell viability analysis
NIH-3T3 cells were seeded into a 96-well plate and allowed to adhere. The cell culture medium was then replaced with complete medium containing avitinib at a series of concentrations (0.16 μM- 2.5 μM), and the cells were incubated at 37 °C for 24 h. On the second day, 20 μL of thiazole blue tetrazole bromide (MTT, 5 mg/mL, Keygene Biotechnology, Nanjing, China) was added to each well followed by incubation at 37 °C for 4 h. Finally, 150 μL of DMSO was added to each well at room temperature, and the absorbance was read at 570 nm by a microplate reader. Cell viability (%) was used to evaluate the ratio of viable cells.
Luciferase assay
In the present study, a luciferase luminescence reporting system was established for the TGF-β1/Smad3 pathway. CAGA-NIH-3T3 cells were established by stably transfecting a plasmid containing 12 copies of the Smad3-binding sequence (CAGA) in front of the luciferase reporter gene upstream of the TGF-β1 promoter; when the CAGA-NIH 3T3 cells were stimulated by TGF-β1, phosphorylated Smad3 was nucleated and bound to CAGA, and luciferase was transcribed and translated, thus resulting in an increase in the luminescence measurement value. Cells were seeded in 96-well plates and cultured overnight. After serum starvation for approximately 20 h, cells were treated with TGF-β1 (5 ng/mL) and/or avitinib (0, 0.16, 0.31, 0.62, 1.25, and 2.5 μM) in DMEM with 0.1% FBS for 18 h. The lysates were used to determine luciferase activity with a luminescence detection system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Total light emission of plates was detected using a GloMax®-Multi Detection System (Promega, Madison, USA).
Immunofluorescence
NIH-3T3 cells were treated with TGF-β1 (5 ng/mL) and/or avitinib (1.25 and 2.5 µM) in DMEM with 0.1% FBS for 24 h. Cells were then fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.2% Triton X-100, blocked with 5% BSA, and then incubated with α-SMA primary antibody overnight at 4 °C. Cells were then washed three times with 1 × PBS-T (3 min per wash) and incubated with fluorescein (FITC)-conjugated AffiniPure goat anti-mouse IgG (H + L) (Jackson Immunoresearch, West Grove, PA, USA) for 2 h at room temperature in the dark. Cellular nuclei were stained with DAPI solution (Solarbio, Beijing, China), and cells were imaged using a Leica TCS SP8 confocal laser scanning microscope (Leica, Germany).
Statistical analysis
The results were analysed by Prism software (version 7.0) and are presented as the mean ± SD. One-way ANOVA was used to analyse significant differences and concordance. The variance homogeneity test was conducted on the data before one-way ANOVA. Statistical analysis was performed with subsequent Bonferroni correction, and comparisons between different groups were performed. p < 0.05 was considered statistically significant.
Discussion
Idiopathic pulmonary fibrosis is a complex lung disease with an unknown pathogeny, and the administration of bleomycin in a mouse model was used to evaluate the effect of antifibrotic strategies and assess pulmonary fibrogenesis [
28]. In an animal model of bleomycin-induced pulmonary fibrosis, avitinib significantly improved pulmonary function and alveolar collapse, and it decreased the content of hydroxyproline, which is a main component of collagen. The IPF lung is characterized by collagen deposition, and reversing this condition alleviates fibrotic development [
32]. FVC is a pulmonary functional parameter that reflects parenchymal abnormalities in IPF patients, and FVC changes indicate disease progression [
33,
34]. Nintedanib has been approved for the treatment of IPF by the Food and Drug Administration (FDA), and this drug significantly reduces the annual rate of FVC decline compared to placebo in clinical tests [
35]. In the present study, nintedanib served as a positive control drug in the in vivo experiments, and the results showed that the anti-pulmonary fibrosis effect of high concentrations of avitinib was equivalent to that of nintedanib, indicating that avitinib has potential to be developed as a therapeutic drug for bleomycin-induced pulmonary fibrosis. Because the efficacy of the drug at the animal level was different from the therapeutic effect at the clinical level, we will continue to compare and evaluate the anti-pulmonary fibrosis efficacy of avitinib based on dosage adjustments and drug safety profiles.
TGF-β1 is a core regulator in the fibrotic progression of IPF patients [
36], and canonical TGF-β1 signalling regulates the expression of fibrotic factors via phosphorylation of Smad transcription factors [
37]. Smad3 plays an essential role in TGF-β1 signalling. Specifically, Smad3 interacts with Smad4, the shared R-Smad partner, to regulate fibrosis-related transcription factors [
11,
38,
39]. As a receptor-regulated Smad (R-Smad), Smad3 often functions with Smad2 and interacts with Smad4 in cells. In view of the role of the two R-Smads, changes in their protein levels are often studied. Pulmonary fibroblasts are involved in wound healing after lung injury, and fibroblasts from IPF patients exhibit the characteristics of stress activation and migration compared to those obtained from normal controls [
11]. ECM proteins are mainly secreted by pulmonary fibroblasts, and their overexpression can lead to irreversible scar formation in IPF lungs. Pulmonary fibroblast activation and migration as well as ECM accumulation are mainly regulated by the TGF-β1/Smad3 signalling pathway [
40,
41]. In addition, some small molecule compounds (nintedanib, pirfenidone, regorafenib, anlotinib, and imatinib) have been shown to alleviate bleomycin-induced pulmonary fibrosis by downregulating the TGF-β1/Smad3 signalling pathway [
26,
34,
42‐
44]. Therefore, these results indicated that avitinib significantly attenuates bleomycin-induced pulmonary fibrosis mainly by suppressing TGF-β1/Smad signalling in vivo, but further in vitro mechanistic studies are needed.
In cellular and animal experiment results, avitinib positively regulates E-cadherin expression and negatively regulates vimentin expression after TGF-β1 or bleomycin simulation, thereby significantly improving epithelial cell injury. Epithelial cell dysfunction plays an essential role in fibrotic progression [
45]. Chronic inflammatory conditions in the lung tissue contribute to epithelial cell injury, and injured cells secrete various profibrotic factors that promote mesenchymal cell migration, proliferation and activation in the fibrotic foci of the lung [
46]. Vimentin protein promotes the invasiveness of IPF fibroblasts, and TGF-β1 upregulates vimentin expression [
47,
48]. E-cadherin is a transmembrane glycoprotein that mediates cell‒cell adhesion in alveolar epithelial cells, and TGF-β1 decreases E-cadherin expression levels [
49,
50]. At the same time, previous studies have found that changes in E-cadherin and vimentin protein expression in human and mouse lung epithelial cells promote the EMT process of fibrosis [
51]. Therefore, these findings suggest that avitinib also participates in the related EMT process through E-cadherin and vimentin.
In conclusion, avitinib alleviates bleomycin-induced pulmonary fibrosis and inhibits lung fibroblast activation, migration and ECM accumulation by inhibiting TGF-β1/Smad3 signalling. In addition, avitinib improves epithelial cell injury by regulating vimentin and E-cadherin expression. The antifibrotic pharmacological activity of avitinib suggests that it has a variety of roles other than antitumour effects and may represent a candidate drug for the treatment of pulmonary fibrosis. However, the present study had limitations. For instance, we did not investigate the detailed mechanism of the effect of avitinib on the TGF-β-mediated Smad3 signalling pathway, and the direct target of avitinib in the anti-pulmonary fibrosis process remains unclear. Therefore, the precise effect of avitinib on the TGF-β signalling pathway should be investigated in the future. Moreover, further studies are needed to determine whether avitinib affects other signalling pathways related to pulmonary fibrosis, such as the recognized targets of EGFR and BTK.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.